EMAIL THIS PAGE TO A FRIEND

LINC00469

long intergenic non-protein coding RNA 469

33 Gene Product Result for
Synonyms: C17orf54
Species: Human LINC00469(283982)
UniProtKB ID: Q8N7U9, Q495E4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182564 Rosetta Predictions human pricing
XR_041403 Rosetta Predictions human pricing
XR_041404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108985 predicted 794
2 SASI_Hs01_00108986 predicted 518
3 SASI_Hs01_00108987 predicted 537
4 SASI_Hs01_00108988 predicted 1012
5 SASI_Hs01_00108989 predicted 913
6 SASI_Hs01_00108990 predicted 494
7 SASI_Hs01_00108991 predicted 298
8 SASI_Hs01_00108992 predicted 333
9 SASI_Hs01_00108993 predicted 292
10 SASI_Hs01_00108994 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527056 predicted 436
2 SASI_Hs02_00527057 predicted 428
3 SASI_Hs02_00527058 predicted 437
4 SASI_Hs02_00527059 predicted 393
5 SASI_Hs02_00527060 predicted 434
6 SASI_Hs02_00527061 predicted 397
7 SASI_Hs02_00527062 predicted 421
8 SASI_Hs02_00527063 predicted 380
9 SASI_Hs02_00527064 predicted 397
10 SASI_Hs02_00527065 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527066 predicted 388
2 SASI_Hs02_00527067 predicted 573
3 SASI_Hs02_00527068 predicted 522
4 SASI_Hs02_00527069 predicted 379
5 SASI_Hs02_00527070 predicted 429
6 SASI_Hs02_00527071 predicted 393
7 SASI_Hs02_00527072 predicted 503
8 SASI_Hs02_00527073 predicted 403
9 SASI_Hs02_00527074 predicted 462
10 SASI_Hs02_00527075 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182564
LINC00469 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 469
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182564.1-334s1c1
Sequence:CCGGCCAGTCCTAAAGCAATGCACTCTCGAGAGTGCATTGCTTTAGGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-783s1c1
Sequence:CCGGGCTGCTGTATCACTCACCAAACTCGAGTTTGGTGAGTGATACAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182564.1-133s1c1
Sequence:CCGGGTGTCCAGACATATCCAGATGCTCGAGCATCTGGATATGTCTGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-1257s1c1
Sequence:CCGGGCATGTGATGACCTTATTCATCTCGAGATGAATAAGGTCATCACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-1375s1c1
Sequence:CCGGGCCTTCTTCATGCATGTGATTCTCGAGAATCACATGCATGAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182564.1-340s1c1
Sequence:CCGGCTAAAGCAATGCACTAATCCACTCGAGTGGATTAGTGCATTGCTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182564
LINC00469 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 469
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182564.1-334s1c1
Sequence:CCGGCCAGTCCTAAAGCAATGCACTCTCGAGAGTGCATTGCTTTAGGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-783s1c1
Sequence:CCGGGCTGCTGTATCACTCACCAAACTCGAGTTTGGTGAGTGATACAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182564.1-133s1c1
Sequence:CCGGGTGTCCAGACATATCCAGATGCTCGAGCATCTGGATATGTCTGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-1257s1c1
Sequence:CCGGGCATGTGATGACCTTATTCATCTCGAGATGAATAAGGTCATCACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-1375s1c1
Sequence:CCGGGCCTTCTTCATGCATGTGATTCTCGAGAATCACATGCATGAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182564.1-340s1c1
Sequence:CCGGCTAAAGCAATGCACTAATCCACTCGAGTGGATTAGTGCATTGCTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182564
LINC00469 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 469
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182564.1-334s1c1
Sequence:CCGGCCAGTCCTAAAGCAATGCACTCTCGAGAGTGCATTGCTTTAGGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-783s1c1
Sequence:CCGGGCTGCTGTATCACTCACCAAACTCGAGTTTGGTGAGTGATACAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182564.1-133s1c1
Sequence:CCGGGTGTCCAGACATATCCAGATGCTCGAGCATCTGGATATGTCTGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-1257s1c1
Sequence:CCGGGCATGTGATGACCTTATTCATCTCGAGATGAATAAGGTCATCACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182564.1-1375s1c1
Sequence:CCGGGCCTTCTTCATGCATGTGATTCTCGAGAATCACATGCATGAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182564.1-340s1c1
Sequence:CCGGCTAAAGCAATGCACTAATCCACTCGAGTGGATTAGTGCATTGCTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)