EMAIL THIS PAGE TO A FRIEND

LINC00470

long intergenic non-protein coding RNA 470

11 Gene Product Result for
Synonyms: C18orf2
Species: Human LINC00470(56651)
UniProtKB ID: Q9BZP3, Q9BZP2, Q9BZP4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031416 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171493 predicted 685
2 SASI_Hs01_00171494 predicted 307
3 SASI_Hs01_00171495 predicted 621
4 SASI_Hs01_00171496 predicted 606
5 SASI_Hs01_00171497 predicted 282
6 SASI_Hs01_00171498 predicted 442
7 SASI_Hs01_00171499 predicted 324
8 SASI_Hs01_00171500 predicted 765
9 SASI_Hs01_00171501 predicted 409
10 SASI_Hs01_00171502 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031416
LINC00470 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 470
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-366s1c1
Sequence:CCGGGCCAGTCTGAATTTCAAGAAACTCGAGTTTCTTGAAATTCAGACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-700s1c1
Sequence:CCGGCAGCAAATGTTCTTTGGGAAACTCGAGTTTCCCAAAGAACATTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-121s1c1
Sequence:CCGGGTCAACAGAAGCCAAAGCCATCTCGAGATGGCTTTGGCTTCTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-150s1c1
Sequence:CCGGGCATGCAACAACAAGAAACAACTCGAGTTGTTTCTTGTTGTTGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-644s1c1
Sequence:CCGGGCGACATTTAGAAGCTTTCTTCTCGAGAAGAAAGCTTCTAAATGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-185s1c1
Sequence:CCGGCTAACCACTAATGACGCAAGACTCGAGTCTTGCGTCATTAGTGGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-296s1c1
Sequence:CCGGGTCATTTCATGCTATTGGCTACTCGAGTAGCCAATAGCATGAAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-313s1c1
Sequence:CCGGGCTATTTGAAATTCCTCCTCTCTCGAGAGAGGAGGAATTTCAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031416
LINC00470 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 470
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-366s1c1
Sequence:CCGGGCCAGTCTGAATTTCAAGAAACTCGAGTTTCTTGAAATTCAGACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-700s1c1
Sequence:CCGGCAGCAAATGTTCTTTGGGAAACTCGAGTTTCCCAAAGAACATTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-121s1c1
Sequence:CCGGGTCAACAGAAGCCAAAGCCATCTCGAGATGGCTTTGGCTTCTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-150s1c1
Sequence:CCGGGCATGCAACAACAAGAAACAACTCGAGTTGTTTCTTGTTGTTGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-644s1c1
Sequence:CCGGGCGACATTTAGAAGCTTTCTTCTCGAGAAGAAAGCTTCTAAATGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-185s1c1
Sequence:CCGGCTAACCACTAATGACGCAAGACTCGAGTCTTGCGTCATTAGTGGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-296s1c1
Sequence:CCGGGTCATTTCATGCTATTGGCTACTCGAGTAGCCAATAGCATGAAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-313s1c1
Sequence:CCGGGCTATTTGAAATTCCTCCTCTCTCGAGAGAGGAGGAATTTCAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031416
LINC00470 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 470
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-366s1c1
Sequence:CCGGGCCAGTCTGAATTTCAAGAAACTCGAGTTTCTTGAAATTCAGACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-700s1c1
Sequence:CCGGCAGCAAATGTTCTTTGGGAAACTCGAGTTTCCCAAAGAACATTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-121s1c1
Sequence:CCGGGTCAACAGAAGCCAAAGCCATCTCGAGATGGCTTTGGCTTCTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-150s1c1
Sequence:CCGGGCATGCAACAACAAGAAACAACTCGAGTTGTTTCTTGTTGTTGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031416.1-644s1c1
Sequence:CCGGGCGACATTTAGAAGCTTTCTTCTCGAGAAGAAAGCTTCTAAATGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-185s1c1
Sequence:CCGGCTAACCACTAATGACGCAAGACTCGAGTCTTGCGTCATTAGTGGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-296s1c1
Sequence:CCGGGTCATTTCATGCTATTGGCTACTCGAGTAGCCAATAGCATGAAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031416.1-313s1c1
Sequence:CCGGGCTATTTGAAATTCCTCCTCTCTCGAGAGAGGAGGAATTTCAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)