EMAIL THIS PAGE TO A FRIEND

LINC00471

long intergenic non-protein coding RNA 471

15 Gene Product Result for
Synonyms: C2orf52
Species: Human LINC00471(151477)
UniProtKB ID: Q8N535
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173513 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161619 predicted 544
2 SASI_Hs01_00161620 predicted 394
3 SASI_Hs01_00161621 predicted 372
4 SASI_Hs01_00161624 predicted 438
5 SASI_Hs01_00161625 predicted 376
6 SASI_Hs01_00161626 predicted 544
7 SASI_Hs01_00161627 predicted 514
8 SASI_Hs01_00161628 predicted 523
9 SASI_Hs02_00368289 predicted 341
10 SASI_Hs02_00368290 predicted 490
11 SASI_Hs01_00161622 predicted 446
12 SASI_Hs01_00161623 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173513
LINC00471 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 471
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173513.2-617s1c1
Sequence:CCGGGTGTGCCATTCTACAGCACTTCTCGAGAAGTGCTGTAGAATGGCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173513.2-551s1c1
Sequence:CCGGGAAGATAAAGAATCCTTCTGTCTCGAGACAGAAGGATTCTTTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173513.2-1094s1c1
Sequence:CCGGGAGTTCTGTCTTTATGCTTATCTCGAGATAAGCATAAAGACAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173513
LINC00471 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 471
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173513.2-617s1c1
Sequence:CCGGGTGTGCCATTCTACAGCACTTCTCGAGAAGTGCTGTAGAATGGCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173513.2-551s1c1
Sequence:CCGGGAAGATAAAGAATCCTTCTGTCTCGAGACAGAAGGATTCTTTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173513.2-1094s1c1
Sequence:CCGGGAGTTCTGTCTTTATGCTTATCTCGAGATAAGCATAAAGACAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173513
LINC00471 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 471
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173513.2-617s1c1
Sequence:CCGGGTGTGCCATTCTACAGCACTTCTCGAGAAGTGCTGTAGAATGGCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173513.2-551s1c1
Sequence:CCGGGAAGATAAAGAATCCTTCTGTCTCGAGACAGAAGGATTCTTTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173513.2-1094s1c1
Sequence:CCGGGAGTTCTGTCTTTATGCTTATCTCGAGATAAGCATAAAGACAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)