EMAIL THIS PAGE TO A FRIEND

LINC00472

long intergenic non-protein coding RNA 472

42 Gene Product Result for
Synonyms: C6orf155 dJ288M22.3
Species: Human LINC00472(79940)
UniProtKB ID: Q9H8W2, E1P533, Q5TG13
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024882 Rosetta Predictions human pricing
XR_040926 Rosetta Predictions human pricing
XR_040927 Rosetta Predictions human pricing
XR_040928 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160052 predicted 1545
2 SASI_Hs01_00160053 predicted 1787
3 SASI_Hs01_00160054 predicted 9153
4 SASI_Hs01_00160055 predicted 1641
5 SASI_Hs01_00160056 predicted 7561
6 SASI_Hs01_00160057 predicted 3917
7 SASI_Hs01_00160058 predicted 8917
8 SASI_Hs01_00160059 predicted 6039
9 SASI_Hs01_00160060 predicted 3544
10 SASI_Hs01_00160061 predicted 6573
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523149 predicted 383
2 SASI_Hs02_00523150 predicted 248
3 SASI_Hs02_00523151 predicted 273
4 SASI_Hs02_00523152 predicted 432
5 SASI_Hs02_00523153 predicted 376
6 SASI_Hs02_00523154 predicted 377
7 SASI_Hs02_00523155 predicted 963
8 SASI_Hs02_00523156 predicted 425
9 SASI_Hs02_00523157 predicted 507
10 SASI_Hs02_00523158 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523159 predicted 386
2 SASI_Hs02_00523160 predicted 250
3 SASI_Hs02_00523161 predicted 269
4 SASI_Hs02_00523162 predicted 424
5 SASI_Hs02_00523163 predicted 380
6 SASI_Hs02_00523164 predicted 382
7 SASI_Hs02_00523165 predicted 965
8 SASI_Hs02_00523166 predicted 429
9 SASI_Hs02_00523167 predicted 505
10 SASI_Hs02_00523168 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523169 predicted 387
2 SASI_Hs02_00523170 predicted 247
3 SASI_Hs02_00523171 predicted 271
4 SASI_Hs02_00523172 predicted 427
5 SASI_Hs02_00523173 predicted 379
6 SASI_Hs02_00523174 predicted 377
7 SASI_Hs02_00523175 predicted 966
8 SASI_Hs02_00523176 predicted 428
9 SASI_Hs02_00523177 predicted 503
10 SASI_Hs02_00523178 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024882
LINC00472 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 472
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000159788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2394s1c1
Sequence:CCGGGCATTTCATCTTCATTGGATACTCGAGTATCCAATGAAGATGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2601s1c1
Sequence:CCGGCCTGAATTAAGAGGTGCTGTTCTCGAGAACAGCACCTCTTAATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2330s1c1
Sequence:CCGGCCTTGGGAATGATTTCATATTCTCGAGAATATGAAATCATTCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-966s1c1
Sequence:CCGGCCAGGTAATAACTTTGATCATCTCGAGATGATCAAAGTTATTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-1790s1c1
Sequence:CCGGCCAGATCATTAGCTTCTTAAACTCGAGTTTAAGAAGCTAATGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-1026s1c1
Sequence:CCGGCCTTACTTGTACTACCTTATTCTCGAGAATAAGGTAGTACAAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024882
LINC00472 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 472
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000159788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2394s1c1
Sequence:CCGGGCATTTCATCTTCATTGGATACTCGAGTATCCAATGAAGATGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2601s1c1
Sequence:CCGGCCTGAATTAAGAGGTGCTGTTCTCGAGAACAGCACCTCTTAATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2330s1c1
Sequence:CCGGCCTTGGGAATGATTTCATATTCTCGAGAATATGAAATCATTCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-966s1c1
Sequence:CCGGCCAGGTAATAACTTTGATCATCTCGAGATGATCAAAGTTATTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-1790s1c1
Sequence:CCGGCCAGATCATTAGCTTCTTAAACTCGAGTTTAAGAAGCTAATGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-1026s1c1
Sequence:CCGGCCTTACTTGTACTACCTTATTCTCGAGAATAAGGTAGTACAAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024882
LINC00472 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 472
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000159788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2394s1c1
Sequence:CCGGGCATTTCATCTTCATTGGATACTCGAGTATCCAATGAAGATGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2601s1c1
Sequence:CCGGCCTGAATTAAGAGGTGCTGTTCTCGAGAACAGCACCTCTTAATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-2330s1c1
Sequence:CCGGCCTTGGGAATGATTTCATATTCTCGAGAATATGAAATCATTCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-966s1c1
Sequence:CCGGCCAGGTAATAACTTTGATCATCTCGAGATGATCAAAGTTATTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-1790s1c1
Sequence:CCGGCCAGATCATTAGCTTCTTAAACTCGAGTTTAAGAAGCTAATGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024882.1-1026s1c1
Sequence:CCGGCCTTACTTGTACTACCTTATTCTCGAGAATAAGGTAGTACAAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)