EMAIL THIS PAGE TO A FRIEND

LINC00474

long intergenic non-protein coding RNA 474

13 Gene Product Result for
Synonyms: C9orf27 EST-YD1
Species: Human LINC00474(58483)
UniProtKB ID: Q9P2X8, Q08EI2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021208 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038723 predicted 299
2 SASI_Hs01_00038724 predicted 344
3 SASI_Hs01_00038725 predicted 498
4 SASI_Hs01_00038726 predicted 415
5 SASI_Hs01_00038727 predicted 540
6 SASI_Hs01_00038728 predicted 330
7 SASI_Hs01_00038729 predicted 350
8 SASI_Hs01_00038730 predicted 315
9 SASI_Hs01_00038731 predicted 510
10 SASI_Hs01_00038732 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021208
LINC00474 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 474
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-314s1c1
Sequence:CCGGCATCCATGAATCTAGATTGCACTCGAGTGCAATCTAGATTCATGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-321s1c1
Sequence:CCGGGAATCTAGATTGCAGGGATGTCTCGAGACATCCCTGCAATCTAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-303s1c1
Sequence:CCGGGCAGACTCATCCATCCATGAACTCGAGTTCATGGATGGATGAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021208.1-304s1c1
Sequence:CCGGCAGACTCATCCATCCATGAATCTCGAGATTCATGGATGGATGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021208.1-610s1c1
Sequence:CCGGGCCTAATTTGAGTCATGCAAACTCGAGTTTGCATGACTCAAATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-371s1c1
Sequence:CCGGCCTCATCATCATCTTCTTCAACTCGAGTTGAAGAAGATGATGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021208
LINC00474 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 474
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-314s1c1
Sequence:CCGGCATCCATGAATCTAGATTGCACTCGAGTGCAATCTAGATTCATGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-321s1c1
Sequence:CCGGGAATCTAGATTGCAGGGATGTCTCGAGACATCCCTGCAATCTAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-303s1c1
Sequence:CCGGGCAGACTCATCCATCCATGAACTCGAGTTCATGGATGGATGAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021208.1-304s1c1
Sequence:CCGGCAGACTCATCCATCCATGAATCTCGAGATTCATGGATGGATGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021208.1-610s1c1
Sequence:CCGGGCCTAATTTGAGTCATGCAAACTCGAGTTTGCATGACTCAAATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-371s1c1
Sequence:CCGGCCTCATCATCATCTTCTTCAACTCGAGTTGAAGAAGATGATGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021208
LINC00474 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 474
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-314s1c1
Sequence:CCGGCATCCATGAATCTAGATTGCACTCGAGTGCAATCTAGATTCATGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-321s1c1
Sequence:CCGGGAATCTAGATTGCAGGGATGTCTCGAGACATCCCTGCAATCTAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-303s1c1
Sequence:CCGGGCAGACTCATCCATCCATGAACTCGAGTTCATGGATGGATGAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021208.1-304s1c1
Sequence:CCGGCAGACTCATCCATCCATGAATCTCGAGATTCATGGATGGATGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021208.1-610s1c1
Sequence:CCGGGCCTAATTTGAGTCATGCAAACTCGAGTTTGCATGACTCAAATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021208.1-371s1c1
Sequence:CCGGCCTCATCATCATCTTCTTCAACTCGAGTTGAAGAAGATGATGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)