EMAIL THIS PAGE TO A FRIEND

LINC00477

long intergenic non-protein coding RNA 477

47 Gene Product Result for
Synonyms: C12orf67 FAM191B
Species: Human LINC00477(144360)
UniProtKB ID: Q96M19
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144667 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364556 predicted 629
2 SASI_Hs01_00239175 predicted 615
3 SASI_Hs01_00239176 predicted 688
4 SASI_Hs01_00239177 predicted 682
5 SASI_Hs01_00239179 predicted 626
6 SASI_Hs01_00239180 predicted 728
7 SASI_Hs01_00239181 predicted 685
8 SASI_Hs01_00239182 predicted 823
9 SASI_Hs01_00239173 predicted 626
10 SASI_Hs01_00239174 predicted 622
11 SASI_Hs01_00239178 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144667
LINC00477 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 477
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-165s1c1
Sequence:CCGGCCTCAATGACTGGCTGCTTTACTCGAGTAAAGCAGCCAGTCATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-180s1c1
Sequence:CCGGGCTTTACCTTCTTCTTGGACTCTCGAGAGTCCAAGAAGAAGGTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144667.1-1329s1c1
Sequence:CCGGGCTAAGACTATAATCCCTTAACTCGAGTTAAGGGATTATAGTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-181s1c1
Sequence:CCGGCTTTACCTTCTTCTTGGACTTCTCGAGAAGTCCAAGAAGAAGGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-186s1c1
Sequence:CCGGCCTTCTTCTTGGACTTCATCTCTCGAGAGATGAAGTCCAAGAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144667.1-1149s1c1
Sequence:CCGGCCTACTCAACATGAAGATGATCTCGAGATCATCTTCATGTTGAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144667
LINC00477 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 477
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-165s1c1
Sequence:CCGGCCTCAATGACTGGCTGCTTTACTCGAGTAAAGCAGCCAGTCATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-180s1c1
Sequence:CCGGGCTTTACCTTCTTCTTGGACTCTCGAGAGTCCAAGAAGAAGGTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144667.1-1329s1c1
Sequence:CCGGGCTAAGACTATAATCCCTTAACTCGAGTTAAGGGATTATAGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-181s1c1
Sequence:CCGGCTTTACCTTCTTCTTGGACTTCTCGAGAAGTCCAAGAAGAAGGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-186s1c1
Sequence:CCGGCCTTCTTCTTGGACTTCATCTCTCGAGAGATGAAGTCCAAGAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144667.1-1149s1c1
Sequence:CCGGCCTACTCAACATGAAGATGATCTCGAGATCATCTTCATGTTGAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144667
LINC00477 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 477
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-165s1c1
Sequence:CCGGCCTCAATGACTGGCTGCTTTACTCGAGTAAAGCAGCCAGTCATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-180s1c1
Sequence:CCGGGCTTTACCTTCTTCTTGGACTCTCGAGAGTCCAAGAAGAAGGTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144667.1-1329s1c1
Sequence:CCGGGCTAAGACTATAATCCCTTAACTCGAGTTAAGGGATTATAGTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-181s1c1
Sequence:CCGGCTTTACCTTCTTCTTGGACTTCTCGAGAAGTCCAAGAAGAAGGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144667.1-186s1c1
Sequence:CCGGCCTTCTTCTTGGACTTCATCTCTCGAGAGATGAAGTCCAAGAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144667.1-1149s1c1
Sequence:CCGGCCTACTCAACATGAAGATGATCTCGAGATCATCTTCATGTTGAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)