EMAIL THIS PAGE TO A FRIEND

LINC00478

long intergenic non-protein coding RNA 478

91 Gene Product Result for
Synonyms: C21orf34 C21orf35 FLJ38295
Species: Human LINC00478(388815)
UniProtKB ID: A1L4M7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4100302 Monoclonal Anti-C21orf34 antibody produced in mouse clone C21orf34-A256, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005732 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102351 MISSION® esiRNA esiRNA human C21orf34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005732 Rosetta Predictions human pricing
NM_001005733 Rosetta Predictions human pricing
NM_001005734 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181071 predicted 375
2 SASI_Hs01_00181072 predicted 299
3 SASI_Hs01_00181073 predicted 276
4 SASI_Hs01_00181075 predicted 581
5 SASI_Hs01_00181076 predicted 641
6 SASI_Hs01_00181077 predicted 577
7 SASI_Hs01_00181078 predicted 287
8 SASI_Hs01_00181080 predicted 502
9 SASI_Hs02_00304999 predicted 246
10 SASI_Hs02_00305000 predicted 244
11 SASI_Hs01_00181074 predicted 328
12 SASI_Hs01_00181079 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139054 predicted 480
2 SASI_Hs01_00139055 predicted 380
3 SASI_Hs01_00139056 predicted 530
4 SASI_Hs02_00305001 predicted 284
5 SASI_Hs01_00139057 predicted 419
6 SASI_Hs01_00139059 predicted 286
7 SASI_Hs01_00139060 predicted 569
8 SASI_Hs01_00139061 predicted 510
9 SASI_Hs01_00139062 predicted 251
10 SASI_Hs01_00139063 predicted 527
11 SASI_Hs01_00139058 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208444 predicted 377
2 SASI_Hs01_00208446 predicted 291
3 SASI_Hs01_00208447 predicted 340
4 SASI_Hs02_00305002 predicted 332
5 SASI_Hs01_00208448 predicted 413
6 SASI_Hs01_00208449 predicted 359
7 SASI_Hs02_00305003 predicted 335
8 SASI_Hs01_00208450 predicted 222
9 SASI_Hs01_00208451 predicted 379
10 SASI_Hs01_00208452 predicted 332
11 SASI_Hs01_00208445 predicted 341
12 SASI_Hs01_00208453 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005732
LINC00478 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 478
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005732.1-184s1c1
Sequence:CCGGCGACAACAAGAGAGACAGAAACTCGAGTTTCTGTCTCTCTTGTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005732.1-335s1c1
Sequence:CCGGGATGTGAAGATGAGAAGAAATCTCGAGATTTCTTCTCATCTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005732.1-635s1c1
Sequence:CCGGCCTTTGAATTAGCTTTCCCTACTCGAGTAGGGAAAGCTAATTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005732.1-171s1c1
Sequence:CCGGGATTTGCTTCAAACGACAACACTCGAGTGTTGTCGTTTGAAGCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005732
LINC00478 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 478
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005732.1-184s1c1
Sequence:CCGGCGACAACAAGAGAGACAGAAACTCGAGTTTCTGTCTCTCTTGTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005732.1-335s1c1
Sequence:CCGGGATGTGAAGATGAGAAGAAATCTCGAGATTTCTTCTCATCTTCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005732.1-635s1c1
Sequence:CCGGCCTTTGAATTAGCTTTCCCTACTCGAGTAGGGAAAGCTAATTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005732.1-171s1c1
Sequence:CCGGGATTTGCTTCAAACGACAACACTCGAGTGTTGTCGTTTGAAGCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005732
LINC00478 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 478
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005732.1-184s1c1
Sequence:CCGGCGACAACAAGAGAGACAGAAACTCGAGTTTCTGTCTCTCTTGTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005732.1-335s1c1
Sequence:CCGGGATGTGAAGATGAGAAGAAATCTCGAGATTTCTTCTCATCTTCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005732.1-635s1c1
Sequence:CCGGCCTTTGAATTAGCTTTCCCTACTCGAGTAGGGAAAGCTAATTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005732.1-171s1c1
Sequence:CCGGGATTTGCTTCAAACGACAACACTCGAGTGTTGTCGTTTGAAGCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)