EMAIL THIS PAGE TO A FRIEND

LINC00479

long intergenic non-protein coding RNA 479

43 Gene Product Result for
Synonyms: C21orf129
Species: Human LINC00479(150135)
UniProtKB ID: Q96M42, D3DSJ3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152506 Rosetta Predictions human pricing
XR_040346 Rosetta Predictions human pricing
XR_040347 Rosetta Predictions human pricing
XR_040348 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221078 predicted 397
2 SASI_Hs01_00221079 predicted 518
3 SASI_Hs01_00221080 predicted 595
4 SASI_Hs01_00221081 predicted 601
5 SASI_Hs01_00221082 predicted 391
6 SASI_Hs01_00221083 predicted 410
7 SASI_Hs01_00221084 predicted 518
8 SASI_Hs01_00221085 predicted 578
9 SASI_Hs01_00221086 predicted 440
10 SASI_Hs01_00221087 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518032 predicted 426
2 SASI_Hs02_00518033 predicted 477
3 SASI_Hs02_00518034 predicted 330
4 SASI_Hs02_00518035 predicted 444
5 SASI_Hs02_00518036 predicted 330
6 SASI_Hs02_00518037 predicted 281
7 SASI_Hs02_00518038 predicted 342
8 SASI_Hs02_00518039 predicted 344
9 SASI_Hs02_00518040 predicted 478
10 SASI_Hs02_00518041 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518042 predicted 431
2 SASI_Hs02_00518043 predicted 482
3 SASI_Hs02_00518044 predicted 337
4 SASI_Hs02_00518045 predicted 445
5 SASI_Hs02_00518046 predicted 333
6 SASI_Hs02_00518047 predicted 278
7 SASI_Hs02_00518048 predicted 344
8 SASI_Hs02_00518049 predicted 338
9 SASI_Hs02_00518050 predicted 482
10 SASI_Hs02_00518051 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518052 predicted 479
2 SASI_Hs02_00518053 predicted 336
3 SASI_Hs02_00518054 predicted 428
4 SASI_Hs02_00518055 predicted 442
5 SASI_Hs02_00518056 predicted 333
6 SASI_Hs02_00518057 predicted 277
7 SASI_Hs02_00518058 predicted 337
8 SASI_Hs02_00518059 predicted 482
9 SASI_Hs02_00518060 predicted 395
10 SASI_Hs02_00518061 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152506
LINC00479 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 479
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-524s1c1
Sequence:CCGGGTTAATTATTCACGTGGCCTGCTCGAGCAGGCCACGTGAATAATTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-404s1c1
Sequence:CCGGCTGGAGAGTTCAAAGTGCCTACTCGAGTAGGCACTTTGAACTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152506.1-772s1c1
Sequence:CCGGCCCAGGCAACATTTATTTATTCTCGAGAATAAATAAATGTTGCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-610s1c1
Sequence:CCGGCGGCAATATTTGCAGTGTTATCTCGAGATAACACTGCAAATATTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-510s1c1
Sequence:CCGGGCTCCCTAGACAGGGTTAATTCTCGAGAATTAACCCTGTCTAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152506.1-716s1c1
Sequence:CCGGCCCAGTGAAATGCAAATGCTACTCGAGTAGCATTTGCATTTCACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-549s1c1
Sequence:CCGGCCAGGGTTCGTTTGTTTGTCTCTCGAGAGACAAACAAACGAACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152506
LINC00479 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 479
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-524s1c1
Sequence:CCGGGTTAATTATTCACGTGGCCTGCTCGAGCAGGCCACGTGAATAATTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-404s1c1
Sequence:CCGGCTGGAGAGTTCAAAGTGCCTACTCGAGTAGGCACTTTGAACTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152506.1-772s1c1
Sequence:CCGGCCCAGGCAACATTTATTTATTCTCGAGAATAAATAAATGTTGCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-610s1c1
Sequence:CCGGCGGCAATATTTGCAGTGTTATCTCGAGATAACACTGCAAATATTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-510s1c1
Sequence:CCGGGCTCCCTAGACAGGGTTAATTCTCGAGAATTAACCCTGTCTAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152506.1-716s1c1
Sequence:CCGGCCCAGTGAAATGCAAATGCTACTCGAGTAGCATTTGCATTTCACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-549s1c1
Sequence:CCGGCCAGGGTTCGTTTGTTTGTCTCTCGAGAGACAAACAAACGAACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152506
LINC00479 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 479
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-524s1c1
Sequence:CCGGGTTAATTATTCACGTGGCCTGCTCGAGCAGGCCACGTGAATAATTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-404s1c1
Sequence:CCGGCTGGAGAGTTCAAAGTGCCTACTCGAGTAGGCACTTTGAACTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152506.1-772s1c1
Sequence:CCGGCCCAGGCAACATTTATTTATTCTCGAGAATAAATAAATGTTGCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-610s1c1
Sequence:CCGGCGGCAATATTTGCAGTGTTATCTCGAGATAACACTGCAAATATTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-510s1c1
Sequence:CCGGGCTCCCTAGACAGGGTTAATTCTCGAGAATTAACCCTGTCTAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152506.1-716s1c1
Sequence:CCGGCCCAGTGAAATGCAAATGCTACTCGAGTAGCATTTGCATTTCACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152506.1-549s1c1
Sequence:CCGGCCAGGGTTCGTTTGTTTGTCTCTCGAGAGACAAACAAACGAACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)