EMAIL THIS PAGE TO A FRIEND

LINC00482

long intergenic non-protein coding RNA 482

18 Gene Product Result for
Synonyms: C17orf55
Species: Human LINC00482(284185)
UniProtKB ID: Q8N8I6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178519 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178519 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145803 predicted 691
2 SASI_Hs01_00145805 predicted 701
3 SASI_Hs01_00145808 predicted 712
4 SASI_Hs01_00145809 predicted 679
5 SASI_Hs01_00145811 predicted 1003
6 SASI_Hs02_00369760 predicted 696
7 SASI_Hs02_00369761 predicted 844
8 SASI_Hs02_00369762 predicted 712
9 SASI_Hs01_00145812 predicted 662
10 SASI_Hs02_00369763 predicted 1194
11 SASI_Hs01_00145804 predicted 1170
12 SASI_Hs01_00145806 predicted 1146
13 SASI_Hs01_00145807 predicted 1164
14 SASI_Hs01_00145810 predicted 1138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178519
LINC00482 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 482
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1697s1c1
Sequence:CCGGCCTGGACTTCAACATGTGAATCTCGAGATTCACATGTTGAAGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1645s1c1
Sequence:CCGGCTAAGTATAGTCAGCAGTGATCTCGAGATCACTGCTGACTATACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1658s1c1
Sequence:CCGGGCAGTGATCCTATTTCCCAATCTCGAGATTGGGAAATAGGATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1673s1c1
Sequence:CCGGCCCAATAAGGTCCCATTCTGACTCGAGTCAGAATGGGACCTTATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178519.2-1171s1c1
Sequence:CCGGCAAGGACATTCCTGTGGTTCTCTCGAGAGAACCACAGGAATGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178519.2-691s21c1
Sequence:CCGGTCAGCAGCTCCAGCAATTAGGCTCGAGCCTAATTGCTGGAGCTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178519.2-1567s21c1
Sequence:CCGGTGTCTGGATCTGCCCTTTCTACTCGAGTAGAAAGGGCAGATCCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178519.2-1479s21c1
Sequence:CCGGAGATCATCCTTGGCGTCTGTTCTCGAGAACAGACGCCAAGGATGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178519
LINC00482 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 482
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1697s1c1
Sequence:CCGGCCTGGACTTCAACATGTGAATCTCGAGATTCACATGTTGAAGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1645s1c1
Sequence:CCGGCTAAGTATAGTCAGCAGTGATCTCGAGATCACTGCTGACTATACTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1658s1c1
Sequence:CCGGGCAGTGATCCTATTTCCCAATCTCGAGATTGGGAAATAGGATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1673s1c1
Sequence:CCGGCCCAATAAGGTCCCATTCTGACTCGAGTCAGAATGGGACCTTATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178519.2-1171s1c1
Sequence:CCGGCAAGGACATTCCTGTGGTTCTCTCGAGAGAACCACAGGAATGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178519.2-691s21c1
Sequence:CCGGTCAGCAGCTCCAGCAATTAGGCTCGAGCCTAATTGCTGGAGCTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178519.2-1567s21c1
Sequence:CCGGTGTCTGGATCTGCCCTTTCTACTCGAGTAGAAAGGGCAGATCCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178519.2-1479s21c1
Sequence:CCGGAGATCATCCTTGGCGTCTGTTCTCGAGAACAGACGCCAAGGATGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178519
LINC00482 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 482
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1697s1c1
Sequence:CCGGCCTGGACTTCAACATGTGAATCTCGAGATTCACATGTTGAAGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1645s1c1
Sequence:CCGGCTAAGTATAGTCAGCAGTGATCTCGAGATCACTGCTGACTATACTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1658s1c1
Sequence:CCGGGCAGTGATCCTATTTCCCAATCTCGAGATTGGGAAATAGGATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178519.2-1673s1c1
Sequence:CCGGCCCAATAAGGTCCCATTCTGACTCGAGTCAGAATGGGACCTTATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178519.2-1171s1c1
Sequence:CCGGCAAGGACATTCCTGTGGTTCTCTCGAGAGAACCACAGGAATGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178519.2-691s21c1
Sequence:CCGGTCAGCAGCTCCAGCAATTAGGCTCGAGCCTAATTGCTGGAGCTGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178519.2-1567s21c1
Sequence:CCGGTGTCTGGATCTGCCCTTTCTACTCGAGTAGAAAGGGCAGATCCAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178519.2-1479s21c1
Sequence:CCGGAGATCATCCTTGGCGTCTGTTCTCGAGAACAGACGCCAAGGATGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)