EMAIL THIS PAGE TO A FRIEND

LINC00483

long intergenic non-protein coding RNA 483

33 Gene Product Result for
Synonyms: C17orf73
Species: Human LINC00483(55018)
UniProtKB ID: Q53H64, Q9NWQ1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017928 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017882 Rosetta Predictions human pricing
XR_041415 Rosetta Predictions human pricing
XR_041416 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494810 predicted 235
2 SASI_Hs02_00494811 predicted 257
3 SASI_Hs02_00494812 predicted 237
4 SASI_Hs02_00494813 predicted 259
5 SASI_Hs02_00494814 predicted 226
6 SASI_Hs02_00494815 predicted 225
7 SASI_Hs02_00494816 predicted 220
8 SASI_Hs02_00494817 predicted 444
9 SASI_Hs02_00494818 predicted 134
10 SASI_Hs02_00494819 predicted 23
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527146 predicted 233
2 SASI_Hs02_00527147 predicted 257
3 SASI_Hs02_00527148 predicted 236
4 SASI_Hs02_00527149 predicted 264
5 SASI_Hs02_00527150 predicted 225
6 SASI_Hs02_00527151 predicted 227
7 SASI_Hs02_00527152 predicted 217
8 SASI_Hs02_00527153 predicted 447
9 SASI_Hs02_00527154 predicted 131
10 SASI_Hs02_00527155 predicted 18
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527156 predicted 235
2 SASI_Hs02_00527157 predicted 258
3 SASI_Hs02_00527158 predicted 236
4 SASI_Hs02_00527159 predicted 264
5 SASI_Hs02_00527160 predicted 223
6 SASI_Hs02_00527161 predicted 221
7 SASI_Hs02_00527162 predicted 216
8 SASI_Hs02_00527163 predicted 447
9 SASI_Hs02_00527164 predicted 133
10 SASI_Hs02_00527165 predicted 25
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017928
LINC00483 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 483
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-371s1c1
Sequence:CCGGCTTCAGTACCTTCCTTCACTGCTCGAGCAGTGAAGGAAGGTACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-726s1c1
Sequence:CCGGCCTTCAGATGTCAGCTCAAATCTCGAGATTTGAGCTGACATCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-1716s1c1
Sequence:CCGGCCTCTGCACAATAGCTTCTTTCTCGAGAAAGAAGCTATTGTGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-1432s1c1
Sequence:CCGGCCAGGTGAATATAAACAAGAACTCGAGTTCTTGTTTATATTCACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-366s1c1
Sequence:CCGGCCTTACTTCAGTACCTTCCTTCTCGAGAAGGAAGGTACTGAAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-519s1c1
Sequence:CCGGCTGAGGCTGTAGAAAGTGCTTCTCGAGAAGCACTTTCTACAGCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-193s1c1
Sequence:CCGGGTGTAGAAGCTACCAACCTTTCTCGAGAAAGGTTGGTAGCTTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-739s1c1
Sequence:CCGGGCTCAAATAATCAACCTTCATCTCGAGATGAAGGTTGATTATTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-513s1c1
Sequence:CCGGGATGTGCTGAGGCTGTAGAAACTCGAGTTTCTACAGCCTCAGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017928
LINC00483 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 483
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-371s1c1
Sequence:CCGGCTTCAGTACCTTCCTTCACTGCTCGAGCAGTGAAGGAAGGTACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-726s1c1
Sequence:CCGGCCTTCAGATGTCAGCTCAAATCTCGAGATTTGAGCTGACATCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-1716s1c1
Sequence:CCGGCCTCTGCACAATAGCTTCTTTCTCGAGAAAGAAGCTATTGTGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-1432s1c1
Sequence:CCGGCCAGGTGAATATAAACAAGAACTCGAGTTCTTGTTTATATTCACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-366s1c1
Sequence:CCGGCCTTACTTCAGTACCTTCCTTCTCGAGAAGGAAGGTACTGAAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-519s1c1
Sequence:CCGGCTGAGGCTGTAGAAAGTGCTTCTCGAGAAGCACTTTCTACAGCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-193s1c1
Sequence:CCGGGTGTAGAAGCTACCAACCTTTCTCGAGAAAGGTTGGTAGCTTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-739s1c1
Sequence:CCGGGCTCAAATAATCAACCTTCATCTCGAGATGAAGGTTGATTATTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-513s1c1
Sequence:CCGGGATGTGCTGAGGCTGTAGAAACTCGAGTTTCTACAGCCTCAGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017928
LINC00483 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 483
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-371s1c1
Sequence:CCGGCTTCAGTACCTTCCTTCACTGCTCGAGCAGTGAAGGAAGGTACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-726s1c1
Sequence:CCGGCCTTCAGATGTCAGCTCAAATCTCGAGATTTGAGCTGACATCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-1716s1c1
Sequence:CCGGCCTCTGCACAATAGCTTCTTTCTCGAGAAAGAAGCTATTGTGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-1432s1c1
Sequence:CCGGCCAGGTGAATATAAACAAGAACTCGAGTTCTTGTTTATATTCACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-366s1c1
Sequence:CCGGCCTTACTTCAGTACCTTCCTTCTCGAGAAGGAAGGTACTGAAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-519s1c1
Sequence:CCGGCTGAGGCTGTAGAAAGTGCTTCTCGAGAAGCACTTTCTACAGCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-193s1c1
Sequence:CCGGGTGTAGAAGCTACCAACCTTTCTCGAGAAAGGTTGGTAGCTTCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017928.1-739s1c1
Sequence:CCGGGCTCAAATAATCAACCTTCATCTCGAGATGAAGGTTGATTATTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017928.1-513s1c1
Sequence:CCGGGATGTGCTGAGGCTGTAGAAACTCGAGTTTCTACAGCCTCAGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)