EMAIL THIS PAGE TO A FRIEND

LINC00487

long intergenic non-protein coding RNA 487

40 Gene Product Result for
Species: Human LINC00487(400941)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001695 Rosetta Predictions human pricing
XR_041683 Rosetta Predictions human pricing
XR_041684 Rosetta Predictions human pricing
XR_041685 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018564 predicted 348
2 SASI_Hs01_00018565 predicted 360
3 SASI_Hs01_00018566 predicted 389
4 SASI_Hs01_00018567 predicted 394
5 SASI_Hs01_00018568 predicted 1754
6 SASI_Hs01_00018569 predicted 1994
7 SASI_Hs01_00018570 predicted 1552
8 SASI_Hs01_00018571 predicted 1532
9 SASI_Hs01_00018572 predicted 1962
10 SASI_Hs01_00018573 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529549 predicted 206
2 SASI_Hs02_00529550 predicted 211
3 SASI_Hs02_00529551 predicted 197
4 SASI_Hs02_00529552 predicted 360
5 SASI_Hs02_00529553 predicted 241
6 SASI_Hs02_00529554 predicted 393
7 SASI_Hs02_00529555 predicted 366
8 SASI_Hs02_00529556 predicted 245
9 SASI_Hs02_00529557 predicted 384
10 SASI_Hs02_00529558 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529559 predicted 203
2 SASI_Hs02_00529560 predicted 211
3 SASI_Hs02_00529561 predicted 197
4 SASI_Hs02_00529562 predicted 363
5 SASI_Hs02_00529563 predicted 238
6 SASI_Hs02_00529564 predicted 393
7 SASI_Hs02_00529565 predicted 367
8 SASI_Hs02_00529566 predicted 250
9 SASI_Hs02_00529567 predicted 377
10 SASI_Hs02_00529568 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529569 predicted 209
2 SASI_Hs02_00529570 predicted 208
3 SASI_Hs02_00529571 predicted 203
4 SASI_Hs02_00529572 predicted 361
5 SASI_Hs02_00529573 predicted 246
6 SASI_Hs02_00529574 predicted 387
7 SASI_Hs02_00529575 predicted 360
8 SASI_Hs02_00529576 predicted 246
9 SASI_Hs02_00529577 predicted 377
10 SASI_Hs02_00529578 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001695
LINC00487 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 487
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-252s1c1
Sequence:CCGGCATGTCCCAAGTTGGAAGGAACTCGAGTTCCTTCCAACTTGGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-357s1c1
Sequence:CCGGCAGAGGATCAAGTATCCAGGTCTCGAGACCTGGATACTTGATCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-262s1c1
Sequence:CCGGGTTGGAAGGAAGCTCTGAGAACTCGAGTTCTCAGAGCTTCCTTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-507s1c1
Sequence:CCGGCTTTCAAGATGGCATCTTGTTCTCGAGAACAAGATGCCATCTTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1808s1c1
Sequence:CCGGCCATTCTTACTGGCTGAAATTCTCGAGAATTTCAGCCAGTAAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1340s1c1
Sequence:CCGGCCTCTGGAATAATGATTGAATCTCGAGATTCAATCATTATTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1820s1c1
Sequence:CCGGGCTGAAATTCAAAGCTGATAACTCGAGTTATCAGCTTTGAATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-411s1c1
Sequence:CCGGGAACAATTTGAGAGTGAGAAACTCGAGTTTCTCACTCTCAAATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-399s1c1
Sequence:CCGGGACTCCAATGGAGAACAATTTCTCGAGAAATTGTTCTCCATTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-449s1c1
Sequence:CCGGGAAGTTCAAGATCAAGGTGTTCTCGAGAACACCTTGATCTTGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-321s1c1
Sequence:CCGGCTACAGGAGCAGTCTAGAGTACTCGAGTACTCTAGACTGCTCCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-489s1c1
Sequence:CCGGGAGGACCTGATCTCTCTTCTTCTCGAGAAGAAGAGAGATCAGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001695
LINC00487 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 487
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-252s1c1
Sequence:CCGGCATGTCCCAAGTTGGAAGGAACTCGAGTTCCTTCCAACTTGGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-357s1c1
Sequence:CCGGCAGAGGATCAAGTATCCAGGTCTCGAGACCTGGATACTTGATCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-262s1c1
Sequence:CCGGGTTGGAAGGAAGCTCTGAGAACTCGAGTTCTCAGAGCTTCCTTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-507s1c1
Sequence:CCGGCTTTCAAGATGGCATCTTGTTCTCGAGAACAAGATGCCATCTTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1808s1c1
Sequence:CCGGCCATTCTTACTGGCTGAAATTCTCGAGAATTTCAGCCAGTAAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1340s1c1
Sequence:CCGGCCTCTGGAATAATGATTGAATCTCGAGATTCAATCATTATTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1820s1c1
Sequence:CCGGGCTGAAATTCAAAGCTGATAACTCGAGTTATCAGCTTTGAATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-411s1c1
Sequence:CCGGGAACAATTTGAGAGTGAGAAACTCGAGTTTCTCACTCTCAAATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-399s1c1
Sequence:CCGGGACTCCAATGGAGAACAATTTCTCGAGAAATTGTTCTCCATTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-449s1c1
Sequence:CCGGGAAGTTCAAGATCAAGGTGTTCTCGAGAACACCTTGATCTTGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-321s1c1
Sequence:CCGGCTACAGGAGCAGTCTAGAGTACTCGAGTACTCTAGACTGCTCCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-489s1c1
Sequence:CCGGGAGGACCTGATCTCTCTTCTTCTCGAGAAGAAGAGAGATCAGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001695
LINC00487 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 487
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-252s1c1
Sequence:CCGGCATGTCCCAAGTTGGAAGGAACTCGAGTTCCTTCCAACTTGGGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-357s1c1
Sequence:CCGGCAGAGGATCAAGTATCCAGGTCTCGAGACCTGGATACTTGATCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-262s1c1
Sequence:CCGGGTTGGAAGGAAGCTCTGAGAACTCGAGTTCTCAGAGCTTCCTTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-507s1c1
Sequence:CCGGCTTTCAAGATGGCATCTTGTTCTCGAGAACAAGATGCCATCTTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1808s1c1
Sequence:CCGGCCATTCTTACTGGCTGAAATTCTCGAGAATTTCAGCCAGTAAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1340s1c1
Sequence:CCGGCCTCTGGAATAATGATTGAATCTCGAGATTCAATCATTATTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001695.1-1820s1c1
Sequence:CCGGGCTGAAATTCAAAGCTGATAACTCGAGTTATCAGCTTTGAATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-411s1c1
Sequence:CCGGGAACAATTTGAGAGTGAGAAACTCGAGTTTCTCACTCTCAAATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-399s1c1
Sequence:CCGGGACTCCAATGGAGAACAATTTCTCGAGAAATTGTTCTCCATTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-449s1c1
Sequence:CCGGGAAGTTCAAGATCAAGGTGTTCTCGAGAACACCTTGATCTTGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-321s1c1
Sequence:CCGGCTACAGGAGCAGTCTAGAGTACTCGAGTACTCTAGACTGCTCCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001695.1-489s1c1
Sequence:CCGGGAGGACCTGATCTCTCTTCTTCTCGAGAAGAAGAGAGATCAGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)