EMAIL THIS PAGE TO A FRIEND

LINC00518

long intergenic non-protein coding RNA 518

28 Gene Product Result for
Synonyms: C6orf218
Species: Human LINC00518(221718)
UniProtKB ID: Q8N0U6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011111 MISSION® esiRNA esiRNA targeting human C6orf218 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152738 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110138 predicted 495
2 SASI_Hs01_00110139 predicted 745
3 SASI_Hs01_00110140 predicted 661
4 SASI_Hs01_00110141 predicted 745
5 SASI_Hs01_00110142 predicted 620
6 SASI_Hs02_00366656 predicted 774
7 SASI_Hs01_00110144 predicted 853
8 SASI_Hs01_00110145 predicted 634
9 SASI_Hs01_00110146 predicted 650
10 SASI_Hs01_00110147 predicted 804
11 SASI_Hs01_00110143 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152738
LINC00518 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 518
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000004927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152738.1-928s1c1
Sequence:CCGGGATTCCATTTAGCTTCCAAATCTCGAGATTTGGAAGCTAAATGGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-419s1c1
Sequence:CCGGGCTAGATGGAACCTTAGTGAACTCGAGTTCACTAAGGTTCCATCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-327s1c1
Sequence:CCGGCACCTCCAAAGTGACGACTTACTCGAGTAAGTCGTCACTTTGGAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-392s1c1
Sequence:CCGGCCTCAATGAGAGTGACCAAATCTCGAGATTTGGTCACTCTCATTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152738
LINC00518 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 518
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000004927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152738.1-928s1c1
Sequence:CCGGGATTCCATTTAGCTTCCAAATCTCGAGATTTGGAAGCTAAATGGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-419s1c1
Sequence:CCGGGCTAGATGGAACCTTAGTGAACTCGAGTTCACTAAGGTTCCATCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-327s1c1
Sequence:CCGGCACCTCCAAAGTGACGACTTACTCGAGTAAGTCGTCACTTTGGAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-392s1c1
Sequence:CCGGCCTCAATGAGAGTGACCAAATCTCGAGATTTGGTCACTCTCATTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152738
LINC00518 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 518
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000004927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152738.1-928s1c1
Sequence:CCGGGATTCCATTTAGCTTCCAAATCTCGAGATTTGGAAGCTAAATGGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-419s1c1
Sequence:CCGGGCTAGATGGAACCTTAGTGAACTCGAGTTCACTAAGGTTCCATCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-327s1c1
Sequence:CCGGCACCTCCAAAGTGACGACTTACTCGAGTAAGTCGTCACTTTGGAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152738.1-392s1c1
Sequence:CCGGCCTCAATGAGAGTGACCAAATCTCGAGATTTGGTCACTCTCATTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)