EMAIL THIS PAGE TO A FRIEND

LINC00521

long intergenic non-protein coding RNA 521

12 Gene Product Result for
Synonyms: C14orf48 c14_5713
Species: Human LINC00521(256369)
UniProtKB ID: Q8NCU1, Q8N7S1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107127 Anti-C14ORF48 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152777 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218792 predicted 558
2 SASI_Hs01_00218793 predicted 975
3 SASI_Hs01_00218794 predicted 1039
4 SASI_Hs01_00218795 predicted 1007
5 SASI_Hs01_00218796 predicted 638
6 SASI_Hs01_00218797 predicted 439
7 SASI_Hs01_00218798 predicted 520
8 SASI_Hs01_00218800 predicted 498
9 SASI_Hs01_00218801 predicted 792
10 SASI_Hs02_00366717 predicted 706
11 SASI_Hs01_00218799 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152777
LINC00521 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 521
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-914s1c1
Sequence:CCGGCGGCTACATGCAAATGACCATCTCGAGATGGTCATTTGCATGTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-528s1c1
Sequence:CCGGGAGAGAAGTCGAGAAGCACAACTCGAGTTGTGCTTCTCGACTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-532s1c1
Sequence:CCGGGAAGTCGAGAAGCACAAGCTTCTCGAGAAGCTTGTGCTTCTCGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-559s1c1
Sequence:CCGGGACTATCTGATTAAGGTCCTTCTCGAGAAGGACCTTAATCAGATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-1007s1c1
Sequence:CCGGCGATCTGATTAAGGAGTTCATCTCGAGATGAACTCCTTAATCAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-923s1c1
Sequence:CCGGGCAAATGACCATCACCAACATCTCGAGATGTTGGTGATGGTCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163827    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-848s1c1
Sequence:CCGGCATCACTTACCAGAAGGACATCTCGAGATGTCCTTCTGGTAAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-1004s1c1
Sequence:CCGGGCTCGATCTGATTAAGGAGTTCTCGAGAACTCCTTAATCAGATCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-514s1c1
Sequence:CCGGCAGAAGAAGCTCAAGAGAGAACTCGAGTTCTCTCTTGAGCTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-842s1c1
Sequence:CCGGGCACAGCATCACTTACCAGAACTCGAGTTCTGGTAAGTGATGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-513s1c1
Sequence:CCGGGCAGAAGAAGCTCAAGAGAGACTCGAGTCTCTCTTGAGCTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-522s1c1
Sequence:CCGGGCTCAAGAGAGAAGTCGAGAACTCGAGTTCTCGACTTCTCTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152777
LINC00521 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 521
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-914s1c1
Sequence:CCGGCGGCTACATGCAAATGACCATCTCGAGATGGTCATTTGCATGTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-528s1c1
Sequence:CCGGGAGAGAAGTCGAGAAGCACAACTCGAGTTGTGCTTCTCGACTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-532s1c1
Sequence:CCGGGAAGTCGAGAAGCACAAGCTTCTCGAGAAGCTTGTGCTTCTCGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-559s1c1
Sequence:CCGGGACTATCTGATTAAGGTCCTTCTCGAGAAGGACCTTAATCAGATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-1007s1c1
Sequence:CCGGCGATCTGATTAAGGAGTTCATCTCGAGATGAACTCCTTAATCAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-923s1c1
Sequence:CCGGGCAAATGACCATCACCAACATCTCGAGATGTTGGTGATGGTCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163827    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-848s1c1
Sequence:CCGGCATCACTTACCAGAAGGACATCTCGAGATGTCCTTCTGGTAAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-1004s1c1
Sequence:CCGGGCTCGATCTGATTAAGGAGTTCTCGAGAACTCCTTAATCAGATCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-514s1c1
Sequence:CCGGCAGAAGAAGCTCAAGAGAGAACTCGAGTTCTCTCTTGAGCTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-842s1c1
Sequence:CCGGGCACAGCATCACTTACCAGAACTCGAGTTCTGGTAAGTGATGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-513s1c1
Sequence:CCGGGCAGAAGAAGCTCAAGAGAGACTCGAGTCTCTCTTGAGCTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-522s1c1
Sequence:CCGGGCTCAAGAGAGAAGTCGAGAACTCGAGTTCTCGACTTCTCTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152777
LINC00521 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 521
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-914s1c1
Sequence:CCGGCGGCTACATGCAAATGACCATCTCGAGATGGTCATTTGCATGTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-528s1c1
Sequence:CCGGGAGAGAAGTCGAGAAGCACAACTCGAGTTGTGCTTCTCGACTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-532s1c1
Sequence:CCGGGAAGTCGAGAAGCACAAGCTTCTCGAGAAGCTTGTGCTTCTCGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-559s1c1
Sequence:CCGGGACTATCTGATTAAGGTCCTTCTCGAGAAGGACCTTAATCAGATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-1007s1c1
Sequence:CCGGCGATCTGATTAAGGAGTTCATCTCGAGATGAACTCCTTAATCAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-923s1c1
Sequence:CCGGGCAAATGACCATCACCAACATCTCGAGATGTTGGTGATGGTCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163827    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-848s1c1
Sequence:CCGGCATCACTTACCAGAAGGACATCTCGAGATGTCCTTCTGGTAAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163935    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-1004s1c1
Sequence:CCGGGCTCGATCTGATTAAGGAGTTCTCGAGAACTCCTTAATCAGATCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-514s1c1
Sequence:CCGGCAGAAGAAGCTCAAGAGAGAACTCGAGTTCTCTCTTGAGCTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152777.2-842s1c1
Sequence:CCGGGCACAGCATCACTTACCAGAACTCGAGTTCTGGTAAGTGATGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-513s1c1
Sequence:CCGGGCAGAAGAAGCTCAAGAGAGACTCGAGTCTCTCTTGAGCTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152777.2-522s1c1
Sequence:CCGGGCTCAAGAGAGAAGTCGAGAACTCGAGTTCTCGACTTCTCTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)