EMAIL THIS PAGE TO A FRIEND

LINC00523

long intergenic non-protein coding RNA 523

18 Gene Product Result for
Synonyms: C14orf70
Species: Human LINC00523(283601)
UniProtKB ID: Q86TU6, A2RUP4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007560 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143381 MISSION® esiRNA esiRNA human C14orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007560 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131437 predicted 1489
2 SASI_Hs01_00131438 predicted 1179
3 SASI_Hs01_00131439 predicted 1171
4 SASI_Hs01_00131440 predicted 1092
5 SASI_Hs01_00131441 predicted 1196
6 SASI_Hs01_00131442 predicted 1092
7 SASI_Hs01_00131443 predicted 1488
8 SASI_Hs01_00131444 predicted 1363
9 SASI_Hs01_00131445 predicted 1548
10 SASI_Hs01_00131446 predicted 1548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007560
LINC00523 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 523
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-777s1c1
Sequence:CCGGCTTTCTGTCGAGAAGAGGAGACTCGAGTCTCCTCTTCTCGACAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007560.1-932s1c1
Sequence:CCGGGAACCTGAAAGACGAGGAGAACTCGAGTTCTCCTCGTCTTTCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-843s1c1
Sequence:CCGGCAATCAGATGATGTGCTAGATCTCGAGATCTAGCACATCATCTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-852s1c1
Sequence:CCGGGATGTGCTAGATGGTAACAGACTCGAGTCTGTTACCATCTAGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007560.1-1091s1c1
Sequence:CCGGGAGCTCAGAAAGCTAAAGCAACTCGAGTTGCTTTAGCTTTCTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-917s1c1
Sequence:CCGGGCTGAAATCCAAGCAGAACCTCTCGAGAGGTTCTGCTTGGATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-945s1c1
Sequence:CCGGGAGGAGAAACTCAGATACATACTCGAGTATGTATCTGAGTTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007560.1-785s1c1
Sequence:CCGGCGAGAAGAGGAGATGGAGAATCTCGAGATTCTCCATCTCCTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007560
LINC00523 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 523
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-777s1c1
Sequence:CCGGCTTTCTGTCGAGAAGAGGAGACTCGAGTCTCCTCTTCTCGACAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007560.1-932s1c1
Sequence:CCGGGAACCTGAAAGACGAGGAGAACTCGAGTTCTCCTCGTCTTTCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-843s1c1
Sequence:CCGGCAATCAGATGATGTGCTAGATCTCGAGATCTAGCACATCATCTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-852s1c1
Sequence:CCGGGATGTGCTAGATGGTAACAGACTCGAGTCTGTTACCATCTAGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007560.1-1091s1c1
Sequence:CCGGGAGCTCAGAAAGCTAAAGCAACTCGAGTTGCTTTAGCTTTCTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-917s1c1
Sequence:CCGGGCTGAAATCCAAGCAGAACCTCTCGAGAGGTTCTGCTTGGATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-945s1c1
Sequence:CCGGGAGGAGAAACTCAGATACATACTCGAGTATGTATCTGAGTTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007560.1-785s1c1
Sequence:CCGGCGAGAAGAGGAGATGGAGAATCTCGAGATTCTCCATCTCCTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007560
LINC00523 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 523
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-777s1c1
Sequence:CCGGCTTTCTGTCGAGAAGAGGAGACTCGAGTCTCCTCTTCTCGACAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007560.1-932s1c1
Sequence:CCGGGAACCTGAAAGACGAGGAGAACTCGAGTTCTCCTCGTCTTTCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-843s1c1
Sequence:CCGGCAATCAGATGATGTGCTAGATCTCGAGATCTAGCACATCATCTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-852s1c1
Sequence:CCGGGATGTGCTAGATGGTAACAGACTCGAGTCTGTTACCATCTAGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007560.1-1091s1c1
Sequence:CCGGGAGCTCAGAAAGCTAAAGCAACTCGAGTTGCTTTAGCTTTCTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-917s1c1
Sequence:CCGGGCTGAAATCCAAGCAGAACCTCTCGAGAGGTTCTGCTTGGATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007560.1-945s1c1
Sequence:CCGGGAGGAGAAACTCAGATACATACTCGAGTATGTATCTGAGTTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007560.1-785s1c1
Sequence:CCGGCGAGAAGAGGAGATGGAGAATCTCGAGATTCTCCATCTCCTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)