EMAIL THIS PAGE TO A FRIEND

LINC00525

long intergenic non-protein coding RNA 525

Gene Product Result for
Species: Human LINC00525(84847)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032761
LINC00525 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 525
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-867s1c1
Sequence:CCGGCAAACGATGATGCAGGCTATTCTCGAGAATAGCCTGCATCATCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-737s1c1
Sequence:CCGGCAAATTATTTCCCTCAGTGATCTCGAGATCACTGAGGGAAATAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-721s1c1
Sequence:CCGGCAGATTTGCTTCTTGCCAAATCTCGAGATTTGGCAAGAAGCAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-935s1c1
Sequence:CCGGGTTGGACTGATCGTTCAATTTCTCGAGAAATTGAACGATCAGTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-720s1c1
Sequence:CCGGGCAGATTTGCTTCTTGCCAAACTCGAGTTTGGCAAGAAGCAAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-850s1c1
Sequence:CCGGGCTAAGCTGATAAGTATCAAACTCGAGTTTGATACTTATCAGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032761
LINC00525 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 525
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-867s1c1
Sequence:CCGGCAAACGATGATGCAGGCTATTCTCGAGAATAGCCTGCATCATCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-737s1c1
Sequence:CCGGCAAATTATTTCCCTCAGTGATCTCGAGATCACTGAGGGAAATAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-721s1c1
Sequence:CCGGCAGATTTGCTTCTTGCCAAATCTCGAGATTTGGCAAGAAGCAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-935s1c1
Sequence:CCGGGTTGGACTGATCGTTCAATTTCTCGAGAAATTGAACGATCAGTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-720s1c1
Sequence:CCGGGCAGATTTGCTTCTTGCCAAACTCGAGTTTGGCAAGAAGCAAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-850s1c1
Sequence:CCGGGCTAAGCTGATAAGTATCAAACTCGAGTTTGATACTTATCAGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032761
LINC00525 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 525
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-867s1c1
Sequence:CCGGCAAACGATGATGCAGGCTATTCTCGAGAATAGCCTGCATCATCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-737s1c1
Sequence:CCGGCAAATTATTTCCCTCAGTGATCTCGAGATCACTGAGGGAAATAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-721s1c1
Sequence:CCGGCAGATTTGCTTCTTGCCAAATCTCGAGATTTGGCAAGAAGCAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-935s1c1
Sequence:CCGGGTTGGACTGATCGTTCAATTTCTCGAGAAATTGAACGATCAGTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-720s1c1
Sequence:CCGGGCAGATTTGCTTCTTGCCAAACTCGAGTTTGGCAAGAAGCAAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032761.2-850s1c1
Sequence:CCGGGCTAAGCTGATAAGTATCAAACTCGAGTTTGATACTTATCAGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)