EMAIL THIS PAGE TO A FRIEND

LINC00544

long intergenic non-protein coding RNA 544

12 Gene Product Result for
Species: Human LINC00544(440131)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116935 predicted 462
2 SASI_Hs01_00116936 predicted 463
3 SASI_Hs01_00116937 predicted 431
4 SASI_Hs01_00116938 predicted 456
5 SASI_Hs01_00116939 predicted 470
6 SASI_Hs01_00116940 predicted 418
7 SASI_Hs01_00116941 predicted 435
8 SASI_Hs01_00116942 predicted 463
9 SASI_Hs01_00116943 predicted 373
10 SASI_Hs01_00116944 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010918
LINC00544 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 544
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-372s1c1
Sequence:CCGGCACAAGAAGAGTCGTGGAAGACTCGAGTCTTCCACGACTCTTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-435s1c1
Sequence:CCGGCACATCAATTCTCCCTTTCCTCTCGAGAGGAAAGGGAGAATTGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-530s1c1
Sequence:CCGGGAACATCTGTTTACAGCTTCACTCGAGTGAAGCTGTAAACAGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-467s1c1
Sequence:CCGGGTGTGGAGTGAAATTCTCAGACTCGAGTCTGAGAATTTCACTCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-437s1c1
Sequence:CCGGCATCAATTCTCCCTTTCCTCTCTCGAGAGAGGAAAGGGAGAATTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010918
LINC00544 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 544
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-372s1c1
Sequence:CCGGCACAAGAAGAGTCGTGGAAGACTCGAGTCTTCCACGACTCTTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-435s1c1
Sequence:CCGGCACATCAATTCTCCCTTTCCTCTCGAGAGGAAAGGGAGAATTGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-530s1c1
Sequence:CCGGGAACATCTGTTTACAGCTTCACTCGAGTGAAGCTGTAAACAGATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-467s1c1
Sequence:CCGGGTGTGGAGTGAAATTCTCAGACTCGAGTCTGAGAATTTCACTCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-437s1c1
Sequence:CCGGCATCAATTCTCCCTTTCCTCTCTCGAGAGAGGAAAGGGAGAATTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010918
LINC00544 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 544
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-372s1c1
Sequence:CCGGCACAAGAAGAGTCGTGGAAGACTCGAGTCTTCCACGACTCTTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-435s1c1
Sequence:CCGGCACATCAATTCTCCCTTTCCTCTCGAGAGGAAAGGGAGAATTGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-530s1c1
Sequence:CCGGGAACATCTGTTTACAGCTTCACTCGAGTGAAGCTGTAAACAGATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-467s1c1
Sequence:CCGGGTGTGGAGTGAAATTCTCAGACTCGAGTCTGAGAATTTCACTCCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010918.1-437s1c1
Sequence:CCGGCATCAATTCTCCCTTTCCTCTCTCGAGAGAGGAAAGGGAGAATTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)