EMAIL THIS PAGE TO A FRIEND

LINC00552

long intergenic non-protein coding RNA 552

22 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721620 Rosetta Predictions human pricing
XM_001722928 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00443978 predicted 359
2 SASI_Hs02_00443979 predicted 606
3 SASI_Hs02_00443980 predicted 623
4 SASI_Hs02_00443981 predicted 597
5 SASI_Hs02_00443982 predicted 346
6 SASI_Hs02_00443983 predicted 582
7 SASI_Hs02_00443984 predicted 378
8 SASI_Hs02_00443985 predicted 589
9 SASI_Hs02_00443986 predicted 391
10 SASI_Hs02_00443987 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452123 predicted 1592
2 SASI_Hs02_00452124 predicted 1929
3 SASI_Hs02_00452125 predicted 1654
4 SASI_Hs02_00452126 predicted 1718
5 SASI_Hs02_00452127 predicted 1932
6 SASI_Hs02_00452128 predicted 918
7 SASI_Hs02_00452129 predicted 1173
8 SASI_Hs02_00452130 predicted 902
9 SASI_Hs02_00452131 predicted 932
10 SASI_Hs02_00452132 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137672
LINC00552 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 552
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-659s21c1
Sequence:CCGGCCGAAGAGTCTGGGCAGATAACTCGAGTTATCTGCCCAGACTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137672.1-1697s21c1
Sequence:CCGGGCCCTCAGGAATGGGATAGAACTCGAGTTCTATCCCATTCCTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-156s21c1
Sequence:CCGGTCATTTGAAAGCTCAACATTGCTCGAGCAATGTTGAGCTTTCAAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-82s21c1
Sequence:CCGGCTGGTCATGTGGAGAATTATTCTCGAGAATAATTCTCCACATGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-113s21c1
Sequence:CCGGCACACTCACAATGCGAGAAACCTCGAGGTTTCTCGCATTGTGAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137672
LINC00552 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 552
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-659s21c1
Sequence:CCGGCCGAAGAGTCTGGGCAGATAACTCGAGTTATCTGCCCAGACTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137672.1-1697s21c1
Sequence:CCGGGCCCTCAGGAATGGGATAGAACTCGAGTTCTATCCCATTCCTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-156s21c1
Sequence:CCGGTCATTTGAAAGCTCAACATTGCTCGAGCAATGTTGAGCTTTCAAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-82s21c1
Sequence:CCGGCTGGTCATGTGGAGAATTATTCTCGAGAATAATTCTCCACATGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-113s21c1
Sequence:CCGGCACACTCACAATGCGAGAAACCTCGAGGTTTCTCGCATTGTGAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137672
LINC00552 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 552
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-659s21c1
Sequence:CCGGCCGAAGAGTCTGGGCAGATAACTCGAGTTATCTGCCCAGACTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137672.1-1697s21c1
Sequence:CCGGGCCCTCAGGAATGGGATAGAACTCGAGTTCTATCCCATTCCTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-156s21c1
Sequence:CCGGTCATTTGAAAGCTCAACATTGCTCGAGCAATGTTGAGCTTTCAAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-82s21c1
Sequence:CCGGCTGGTCATGTGGAGAATTATTCTCGAGAATAATTCTCCACATGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137672.1-113s21c1
Sequence:CCGGCACACTCACAATGCGAGAAACCTCGAGGTTTCTCGCATTGTGAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)