EMAIL THIS PAGE TO A FRIEND

LINC00574

long intergenic non-protein coding RNA 574

42 Gene Product Result for
Synonyms: C6orf208 RP1-266L20.3 dJ182D15.1
Species: Human LINC00574(80069)
UniProtKB ID: Q9H8X3, Q495C5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025002 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025002 Rosetta Predictions human pricing
XR_041373 Rosetta Predictions human pricing
XR_041374 Rosetta Predictions human pricing
XR_041375 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142661 predicted 621
2 SASI_Hs01_00142662 predicted 553
3 SASI_Hs01_00142663 predicted 857
4 SASI_Hs01_00142664 predicted 675
5 SASI_Hs01_00142665 predicted 1239
6 SASI_Hs01_00142666 predicted 974
7 SASI_Hs01_00142667 predicted 1155
8 SASI_Hs01_00142668 predicted 653
9 SASI_Hs01_00142669 predicted 486
10 SASI_Hs01_00142670 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526806 predicted 240
2 SASI_Hs02_00526807 predicted 301
3 SASI_Hs02_00526808 predicted 173
4 SASI_Hs02_00526809 predicted 55
5 SASI_Hs02_00526810 predicted 163
6 SASI_Hs02_00526811 predicted 296
7 SASI_Hs02_00526812 predicted 138
8 SASI_Hs02_00526813 predicted 250
9 SASI_Hs02_00526814 predicted 94
10 SASI_Hs02_00526815 predicted 172
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526816 predicted 243
2 SASI_Hs02_00526817 predicted 306
3 SASI_Hs02_00526818 predicted 172
4 SASI_Hs02_00526819 predicted 55
5 SASI_Hs02_00526820 predicted 162
6 SASI_Hs02_00526821 predicted 294
7 SASI_Hs02_00526822 predicted 130
8 SASI_Hs02_00526823 predicted 252
9 SASI_Hs02_00526824 predicted 93
10 SASI_Hs02_00526825 predicted 177
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526826 predicted 243
2 SASI_Hs02_00526827 predicted 301
3 SASI_Hs02_00526828 predicted 172
4 SASI_Hs02_00526829 predicted 52
5 SASI_Hs02_00526830 predicted 165
6 SASI_Hs02_00526831 predicted 296
7 SASI_Hs02_00526832 predicted 138
8 SASI_Hs02_00526833 predicted 253
9 SASI_Hs02_00526834 predicted 93
10 SASI_Hs02_00526835 predicted 174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025002
LINC00574 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 574
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-620s1c1
Sequence:CCGGCCGCACTCTGTCCATTTCATACTCGAGTATGAAATGGACAGAGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-631s1c1
Sequence:CCGGCCATTTCATAAGAGCCCTTGGCTCGAGCCAAGGGCTCTTATGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-522s1c1
Sequence:CCGGGCACTGCAGTGAATCCATGTTCTCGAGAACATGGATTCACTGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-621s1c1
Sequence:CCGGCGCACTCTGTCCATTTCATAACTCGAGTTATGAAATGGACAGAGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-632s1c1
Sequence:CCGGCATTTCATAAGAGCCCTTGGTCTCGAGACCAAGGGCTCTTATGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-527s1c1
Sequence:CCGGGCAGTGAATCCATGTTTCCCTCTCGAGAGGGAAACATGGATTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025002
LINC00574 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 574
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-620s1c1
Sequence:CCGGCCGCACTCTGTCCATTTCATACTCGAGTATGAAATGGACAGAGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-631s1c1
Sequence:CCGGCCATTTCATAAGAGCCCTTGGCTCGAGCCAAGGGCTCTTATGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-522s1c1
Sequence:CCGGGCACTGCAGTGAATCCATGTTCTCGAGAACATGGATTCACTGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-621s1c1
Sequence:CCGGCGCACTCTGTCCATTTCATAACTCGAGTTATGAAATGGACAGAGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-632s1c1
Sequence:CCGGCATTTCATAAGAGCCCTTGGTCTCGAGACCAAGGGCTCTTATGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-527s1c1
Sequence:CCGGGCAGTGAATCCATGTTTCCCTCTCGAGAGGGAAACATGGATTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025002
LINC00574 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 574
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-620s1c1
Sequence:CCGGCCGCACTCTGTCCATTTCATACTCGAGTATGAAATGGACAGAGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-631s1c1
Sequence:CCGGCCATTTCATAAGAGCCCTTGGCTCGAGCCAAGGGCTCTTATGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-522s1c1
Sequence:CCGGGCACTGCAGTGAATCCATGTTCTCGAGAACATGGATTCACTGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-621s1c1
Sequence:CCGGCGCACTCTGTCCATTTCATAACTCGAGTTATGAAATGGACAGAGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-632s1c1
Sequence:CCGGCATTTCATAAGAGCCCTTGGTCTCGAGACCAAGGGCTCTTATGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025002.1-527s1c1
Sequence:CCGGGCAGTGAATCCATGTTTCCCTCTCGAGAGGGAAACATGGATTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)