EMAIL THIS PAGE TO A FRIEND

LINC00575

long intergenic non-protein coding RNA 575

2 Gene Product Result for
Synonyms: C4orf11
Species: Human LINC00575(439934)
UniProtKB ID: Q6W349
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058269 predicted 549
2 SASI_Hs01_00058270 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033661
LINC00575 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 575
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033661.1-589s1c1
Sequence:CCGGGCTCCTCCTGTGCTTGGACATCTCGAGATGTCCAAGCACAGGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033661.1-616s1c1
Sequence:CCGGCCAGGTTCTTCAACCTTTGGACTCGAGTCCAAAGGTTGAAGAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033661
LINC00575 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 575
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033661.1-589s1c1
Sequence:CCGGGCTCCTCCTGTGCTTGGACATCTCGAGATGTCCAAGCACAGGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033661.1-616s1c1
Sequence:CCGGCCAGGTTCTTCAACCTTTGGACTCGAGTCCAAAGGTTGAAGAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033661
LINC00575 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 575
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033661.1-589s1c1
Sequence:CCGGGCTCCTCCTGTGCTTGGACATCTCGAGATGTCCAAGCACAGGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033661.1-616s1c1
Sequence:CCGGCCAGGTTCTTCAACCTTTGGACTCGAGTCCAAAGGTTGAAGAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)