EMAIL THIS PAGE TO A FRIEND

LINC00596

long intergenic non-protein coding RNA 596

34 Gene Product Result for
Synonyms: C14orf165 CNSLT1I7G
Species: Human LINC00596(414767)
UniProtKB ID: Q86U02
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077022 predicted 701
2 SASI_Hs01_00077023 predicted 705
3 SASI_Hs01_00077024 predicted 694
4 SASI_Hs01_00077025 predicted 697
5 SASI_Hs01_00077026 predicted 711
6 SASI_Hs01_00077027 predicted 687
7 SASI_Hs01_00077028 predicted 86
8 SASI_Hs01_00077029 predicted 457
9 SASI_Hs01_00077030 predicted 814
10 SASI_Hs01_00077031 predicted 47
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012717
LINC00596 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 596
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-136s1c1
Sequence:CCGGCCCACTGAAACTGAATCCACTCTCGAGAGTGGATTCAGTTTCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-707s1c1
Sequence:CCGGGTTGTGTTCTTCCAGCTCCATCTCGAGATGGAGCTGGAAGAACACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-738s1c1
Sequence:CCGGGAGAATGAACAACTAGGTGTTCTCGAGAACACCTAGTTGTTCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-579s1c1
Sequence:CCGGGAGTAGCAAGAGTATGTGTTTCTCGAGAAACACATACTCTTGCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-613s1c1
Sequence:CCGGGATTGGAATATCCAAGGACATCTCGAGATGTCCTTGGATATTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-768s1c1
Sequence:CCGGGACAATGATTATGACACAGATCTCGAGATCTGTGTCATAATCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-140s1c1
Sequence:CCGGCTGAAACTGAATCCACTGTTTCTCGAGAAACAGTGGATTCAGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-362s1c1
Sequence:CCGGGAGACAGGGTTTCACCATGTTCTCGAGAACATGGTGAAACCCTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-138s1c1
Sequence:CCGGCACTGAAACTGAATCCACTGTCTCGAGACAGTGGATTCAGTTTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012717
LINC00596 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 596
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-136s1c1
Sequence:CCGGCCCACTGAAACTGAATCCACTCTCGAGAGTGGATTCAGTTTCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-707s1c1
Sequence:CCGGGTTGTGTTCTTCCAGCTCCATCTCGAGATGGAGCTGGAAGAACACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-738s1c1
Sequence:CCGGGAGAATGAACAACTAGGTGTTCTCGAGAACACCTAGTTGTTCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-579s1c1
Sequence:CCGGGAGTAGCAAGAGTATGTGTTTCTCGAGAAACACATACTCTTGCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-613s1c1
Sequence:CCGGGATTGGAATATCCAAGGACATCTCGAGATGTCCTTGGATATTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-768s1c1
Sequence:CCGGGACAATGATTATGACACAGATCTCGAGATCTGTGTCATAATCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-140s1c1
Sequence:CCGGCTGAAACTGAATCCACTGTTTCTCGAGAAACAGTGGATTCAGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-362s1c1
Sequence:CCGGGAGACAGGGTTTCACCATGTTCTCGAGAACATGGTGAAACCCTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-138s1c1
Sequence:CCGGCACTGAAACTGAATCCACTGTCTCGAGACAGTGGATTCAGTTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012717
LINC00596 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 596
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-136s1c1
Sequence:CCGGCCCACTGAAACTGAATCCACTCTCGAGAGTGGATTCAGTTTCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-707s1c1
Sequence:CCGGGTTGTGTTCTTCCAGCTCCATCTCGAGATGGAGCTGGAAGAACACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-738s1c1
Sequence:CCGGGAGAATGAACAACTAGGTGTTCTCGAGAACACCTAGTTGTTCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-579s1c1
Sequence:CCGGGAGTAGCAAGAGTATGTGTTTCTCGAGAAACACATACTCTTGCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-613s1c1
Sequence:CCGGGATTGGAATATCCAAGGACATCTCGAGATGTCCTTGGATATTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012717.1-768s1c1
Sequence:CCGGGACAATGATTATGACACAGATCTCGAGATCTGTGTCATAATCATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-140s1c1
Sequence:CCGGCTGAAACTGAATCCACTGTTTCTCGAGAAACAGTGGATTCAGTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-362s1c1
Sequence:CCGGGAGACAGGGTTTCACCATGTTCTCGAGAACATGGTGAAACCCTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012717.1-138s1c1
Sequence:CCGGCACTGAAACTGAATCCACTGTCTCGAGACAGTGGATTCAGTTTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)