EMAIL THIS PAGE TO A FRIEND

LINC00597

long intergenic non-protein coding RNA 597

33 Gene Product Result for
Synonyms: C15orf5
Species: Human LINC00597(81698)
UniProtKB ID: Q9H2U6, Q3SY27, Q9UMC1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030944 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030944 Rosetta Predictions human pricing
XR_017977 Rosetta Predictions human pricing
XR_041829 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179580 predicted 820
2 SASI_Hs01_00179581 predicted 903
3 SASI_Hs01_00179582 predicted 902
4 SASI_Hs01_00179583 predicted 927
5 SASI_Hs01_00179584 predicted 808
6 SASI_Hs01_00179585 predicted 945
7 SASI_Hs01_00179586 predicted 827
8 SASI_Hs01_00179587 predicted 849
9 SASI_Hs01_00179588 predicted 830
10 SASI_Hs01_00179589 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495147 predicted 470
2 SASI_Hs02_00495148 predicted 470
3 SASI_Hs02_00495149 predicted 554
4 SASI_Hs02_00495150 predicted 595
5 SASI_Hs02_00495151 predicted 598
6 SASI_Hs02_00495152 predicted 443
7 SASI_Hs02_00495153 predicted 454
8 SASI_Hs02_00495154 predicted 593
9 SASI_Hs02_00495155 predicted 498
10 SASI_Hs02_00495156 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530693 predicted 473
2 SASI_Hs02_00530694 predicted 472
3 SASI_Hs02_00530695 predicted 554
4 SASI_Hs02_00530696 predicted 579
5 SASI_Hs02_00530697 predicted 442
6 SASI_Hs02_00530698 predicted 455
7 SASI_Hs02_00530699 predicted 591
8 SASI_Hs02_00530700 predicted 593
9 SASI_Hs02_00530701 predicted 505
10 SASI_Hs02_00530702 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030944
LINC00597 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 597
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-452s1c1
Sequence:CCGGCCTAGAGGCAAAGACATTAGACTCGAGTCTAATGTCTTTGCCTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-716s1c1
Sequence:CCGGCCAGCTGATACAGTGTGCATTCTCGAGAATGCACACTGTATCAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-600s1c1
Sequence:CCGGGAAACACCTCTCTCCATACAACTCGAGTTGTATGGAGAGAGGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-378s1c1
Sequence:CCGGGAACAAGCAAGTCACATGATGCTCGAGCATCATGTGACTTGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-511s1c1
Sequence:CCGGGCTGTGGAAATGGAAAGAGATCTCGAGATCTCTTTCCATTTCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-459s1c1
Sequence:CCGGGCAAAGACATTAGATAGGAGACTCGAGTCTCCTATCTAATGTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-484s1c1
Sequence:CCGGCAGAACAAACTAGACGTGAAACTCGAGTTTCACGTCTAGTTTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-480s1c1
Sequence:CCGGCCACCAGAACAAACTAGACGTCTCGAGACGTCTAGTTTGTTCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-985s1c1
Sequence:CCGGGCACAGAAAGAAAGGCACCATCTCGAGATGGTGCCTTTCTTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-732s1c1
Sequence:CCGGGCATTCACTTACAGCTTCCTTCTCGAGAAGGAAGCTGTAAGTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-408s1c1
Sequence:CCGGGAGGAACATTGTATTTGTGATCTCGAGATCACAAATACAATGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-567s1c1
Sequence:CCGGCATCCAGATTTCATGATAGATCTCGAGATCTATCATGAAATCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030944
LINC00597 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 597
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-452s1c1
Sequence:CCGGCCTAGAGGCAAAGACATTAGACTCGAGTCTAATGTCTTTGCCTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-716s1c1
Sequence:CCGGCCAGCTGATACAGTGTGCATTCTCGAGAATGCACACTGTATCAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-600s1c1
Sequence:CCGGGAAACACCTCTCTCCATACAACTCGAGTTGTATGGAGAGAGGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-378s1c1
Sequence:CCGGGAACAAGCAAGTCACATGATGCTCGAGCATCATGTGACTTGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-511s1c1
Sequence:CCGGGCTGTGGAAATGGAAAGAGATCTCGAGATCTCTTTCCATTTCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-459s1c1
Sequence:CCGGGCAAAGACATTAGATAGGAGACTCGAGTCTCCTATCTAATGTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-484s1c1
Sequence:CCGGCAGAACAAACTAGACGTGAAACTCGAGTTTCACGTCTAGTTTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-480s1c1
Sequence:CCGGCCACCAGAACAAACTAGACGTCTCGAGACGTCTAGTTTGTTCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-985s1c1
Sequence:CCGGGCACAGAAAGAAAGGCACCATCTCGAGATGGTGCCTTTCTTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-732s1c1
Sequence:CCGGGCATTCACTTACAGCTTCCTTCTCGAGAAGGAAGCTGTAAGTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-408s1c1
Sequence:CCGGGAGGAACATTGTATTTGTGATCTCGAGATCACAAATACAATGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-567s1c1
Sequence:CCGGCATCCAGATTTCATGATAGATCTCGAGATCTATCATGAAATCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030944
LINC00597 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 597
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-452s1c1
Sequence:CCGGCCTAGAGGCAAAGACATTAGACTCGAGTCTAATGTCTTTGCCTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-716s1c1
Sequence:CCGGCCAGCTGATACAGTGTGCATTCTCGAGAATGCACACTGTATCAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-600s1c1
Sequence:CCGGGAAACACCTCTCTCCATACAACTCGAGTTGTATGGAGAGAGGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-378s1c1
Sequence:CCGGGAACAAGCAAGTCACATGATGCTCGAGCATCATGTGACTTGCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-511s1c1
Sequence:CCGGGCTGTGGAAATGGAAAGAGATCTCGAGATCTCTTTCCATTTCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-459s1c1
Sequence:CCGGGCAAAGACATTAGATAGGAGACTCGAGTCTCCTATCTAATGTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-484s1c1
Sequence:CCGGCAGAACAAACTAGACGTGAAACTCGAGTTTCACGTCTAGTTTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-480s1c1
Sequence:CCGGCCACCAGAACAAACTAGACGTCTCGAGACGTCTAGTTTGTTCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-985s1c1
Sequence:CCGGGCACAGAAAGAAAGGCACCATCTCGAGATGGTGCCTTTCTTTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030944.1-732s1c1
Sequence:CCGGGCATTCACTTACAGCTTCCTTCTCGAGAAGGAAGCTGTAAGTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-408s1c1
Sequence:CCGGGAGGAACATTGTATTTGTGATCTCGAGATCACAAATACAATGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030944.1-567s1c1
Sequence:CCGGCATCCAGATTTCATGATAGATCTCGAGATCTATCATGAAATCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)