EMAIL THIS PAGE TO A FRIEND

LINC00602

long intergenic non-protein coding RNA 602

12 Gene Product Result for
Species: Human LINC00602(441177)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013720 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013720 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048993 predicted 1721
2 SASI_Hs01_00048994 predicted 1724
3 SASI_Hs01_00048995 predicted 1256
4 SASI_Hs01_00048996 predicted 1718
5 SASI_Hs01_00048997 predicted 1469
6 SASI_Hs01_00048998 predicted 1369
7 SASI_Hs01_00048999 predicted 1469
8 SASI_Hs01_00049000 predicted 1733
9 SASI_Hs01_00049001 predicted 1195
10 SASI_Hs01_00049002 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013720
LINC00602 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 602
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013720.1-977s1c1
Sequence:CCGGGAGTGCAAACAGACATTGGTTCTCGAGAACCAATGTCTGTTTGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1676s1c1
Sequence:CCGGGCAGCTTCATAAATGCACCCACTCGAGTGGGTGCATTTATGAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1677s1c1
Sequence:CCGGCAGCTTCATAAATGCACCCAACTCGAGTTGGGTGCATTTATGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013720.1-742s1c1
Sequence:CCGGGAAATCAAAGCCACCAGAGGACTCGAGTCCTCTGGTGGCTTTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1731s1c1
Sequence:CCGGGAAGTGAACCTAAGGAAGTTTCTCGAGAAACTTCCTTAGGTTCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013720
LINC00602 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 602
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013720.1-977s1c1
Sequence:CCGGGAGTGCAAACAGACATTGGTTCTCGAGAACCAATGTCTGTTTGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1676s1c1
Sequence:CCGGGCAGCTTCATAAATGCACCCACTCGAGTGGGTGCATTTATGAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1677s1c1
Sequence:CCGGCAGCTTCATAAATGCACCCAACTCGAGTTGGGTGCATTTATGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013720.1-742s1c1
Sequence:CCGGGAAATCAAAGCCACCAGAGGACTCGAGTCCTCTGGTGGCTTTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1731s1c1
Sequence:CCGGGAAGTGAACCTAAGGAAGTTTCTCGAGAAACTTCCTTAGGTTCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013720
LINC00602 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 602
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013720.1-977s1c1
Sequence:CCGGGAGTGCAAACAGACATTGGTTCTCGAGAACCAATGTCTGTTTGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1676s1c1
Sequence:CCGGGCAGCTTCATAAATGCACCCACTCGAGTGGGTGCATTTATGAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1677s1c1
Sequence:CCGGCAGCTTCATAAATGCACCCAACTCGAGTTGGGTGCATTTATGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013720.1-742s1c1
Sequence:CCGGGAAATCAAAGCCACCAGAGGACTCGAGTCCTCTGGTGGCTTTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013720.1-1731s1c1
Sequence:CCGGGAAGTGAACCTAAGGAAGTTTCTCGAGAAACTTCCTTAGGTTCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)