EMAIL THIS PAGE TO A FRIEND

LINC00610

long intergenic non-protein coding RNA 610

12 Gene Product Result for
Synonyms: C11orf55
Species: Human LINC00610(399879)
UniProtKB ID: Q6ZST8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378283 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207428 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138744 predicted 773
2 SASI_Hs01_00138745 predicted 741
3 SASI_Hs01_00138746 predicted 871
4 SASI_Hs01_00138747 predicted 802
5 SASI_Hs01_00138748 predicted 787
6 SASI_Hs01_00138749 predicted 820
7 SASI_Hs01_00138750 predicted 1079
8 SASI_Hs01_00138751 predicted 849
9 SASI_Hs01_00138752 predicted 427
10 SASI_Hs01_00138753 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378283
LINC00610 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 610
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378283.1-1505s1c1
Sequence:CCGGCCACATGGTTCGGAAGGATAACTCGAGTTATCCTTCCGAACCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1167s1c1
Sequence:CCGGCGAGCGTCGCAATTTCAAGTTCTCGAGAACTTGAAATTGCGACGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1363s1c1
Sequence:CCGGCTGCTACCTATGCCAGTTGTTCTCGAGAACAACTGGCATAGGTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1333s1c1
Sequence:CCGGCATTCCATGTCCATCTGGCATCTCGAGATGCCAGATGGACATGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1376s1c1
Sequence:CCGGCAGTTGTTCTCAGGATTTGTTCTCGAGAACAAATCCTGAGAACAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378283.1-1996s1c1
Sequence:CCGGGTAACAAACAATCCCAAGGTTCTCGAGAACCTTGGGATTGTTTGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1375s1c1
Sequence:CCGGCCAGTTGTTCTCAGGATTTGTCTCGAGACAAATCCTGAGAACAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1326s1c1
Sequence:CCGGCTAAGGACATTCCATGTCCATCTCGAGATGGACATGGAATGTCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378283
LINC00610 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 610
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378283.1-1505s1c1
Sequence:CCGGCCACATGGTTCGGAAGGATAACTCGAGTTATCCTTCCGAACCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1167s1c1
Sequence:CCGGCGAGCGTCGCAATTTCAAGTTCTCGAGAACTTGAAATTGCGACGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1363s1c1
Sequence:CCGGCTGCTACCTATGCCAGTTGTTCTCGAGAACAACTGGCATAGGTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1333s1c1
Sequence:CCGGCATTCCATGTCCATCTGGCATCTCGAGATGCCAGATGGACATGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1376s1c1
Sequence:CCGGCAGTTGTTCTCAGGATTTGTTCTCGAGAACAAATCCTGAGAACAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378283.1-1996s1c1
Sequence:CCGGGTAACAAACAATCCCAAGGTTCTCGAGAACCTTGGGATTGTTTGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1375s1c1
Sequence:CCGGCCAGTTGTTCTCAGGATTTGTCTCGAGACAAATCCTGAGAACAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1326s1c1
Sequence:CCGGCTAAGGACATTCCATGTCCATCTCGAGATGGACATGGAATGTCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378283
LINC00610 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 610
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378283.1-1505s1c1
Sequence:CCGGCCACATGGTTCGGAAGGATAACTCGAGTTATCCTTCCGAACCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1167s1c1
Sequence:CCGGCGAGCGTCGCAATTTCAAGTTCTCGAGAACTTGAAATTGCGACGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1363s1c1
Sequence:CCGGCTGCTACCTATGCCAGTTGTTCTCGAGAACAACTGGCATAGGTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1333s1c1
Sequence:CCGGCATTCCATGTCCATCTGGCATCTCGAGATGCCAGATGGACATGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1376s1c1
Sequence:CCGGCAGTTGTTCTCAGGATTTGTTCTCGAGAACAAATCCTGAGAACAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378283.1-1996s1c1
Sequence:CCGGGTAACAAACAATCCCAAGGTTCTCGAGAACCTTGGGATTGTTTGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378283.1-1375s1c1
Sequence:CCGGCCAGTTGTTCTCAGGATTTGTCTCGAGACAAATCCTGAGAACAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378283.1-1326s1c1
Sequence:CCGGCTAAGGACATTCCATGTCCATCTCGAGATGGACATGGAATGTCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)