EMAIL THIS PAGE TO A FRIEND

LINC00612

long intergenic non-protein coding RNA 612

44 Gene Product Result for
Synonyms: C12orf33
Species: Human LINC00612(253128)
UniProtKB ID: Q8N6U2, B3KW01
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182550 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223281 MISSION® esiRNA esiRNA targeting human C12orf33 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039381 Rosetta Predictions human pricing
XR_041988 Rosetta Predictions human pricing
XR_041989 Rosetta Predictions human pricing
XR_041990 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097004 predicted 1001
2 SASI_Hs01_00097005 predicted 1491
3 SASI_Hs01_00097006 predicted 1931
4 SASI_Hs01_00097007 predicted 1486
5 SASI_Hs01_00097008 predicted 1880
6 SASI_Hs01_00097009 predicted 1337
7 SASI_Hs01_00097010 predicted 1952
8 SASI_Hs01_00097011 predicted 1307
9 SASI_Hs01_00097012 predicted 1878
10 SASI_Hs01_00097013 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532062 predicted 1813
2 SASI_Hs02_00532063 predicted 1661
3 SASI_Hs02_00532064 predicted 1799
4 SASI_Hs02_00532065 predicted 1802
5 SASI_Hs02_00532066 predicted 1960
6 SASI_Hs02_00532067 predicted 1879
7 SASI_Hs02_00532068 predicted 1807
8 SASI_Hs02_00532069 predicted 1823
9 SASI_Hs02_00532070 predicted 1810
10 SASI_Hs02_00532071 predicted 1955
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532072 predicted 1817
2 SASI_Hs02_00532073 predicted 1664
3 SASI_Hs02_00532074 predicted 1798
4 SASI_Hs02_00532075 predicted 1806
5 SASI_Hs02_00532076 predicted 1957
6 SASI_Hs02_00532077 predicted 1882
7 SASI_Hs02_00532078 predicted 1803
8 SASI_Hs02_00532079 predicted 1827
9 SASI_Hs02_00532080 predicted 1809
10 SASI_Hs02_00532081 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532082 predicted 1820
2 SASI_Hs02_00532083 predicted 1663
3 SASI_Hs02_00532084 predicted 1796
4 SASI_Hs02_00532085 predicted 1803
5 SASI_Hs02_00532086 predicted 1954
6 SASI_Hs02_00532087 predicted 1878
7 SASI_Hs02_00532088 predicted 1806
8 SASI_Hs02_00532089 predicted 1821
9 SASI_Hs02_00532090 predicted 1807
10 SASI_Hs02_00532091 predicted 1952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182550
LINC00612 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 612
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000183819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182550.1-1089s1c1
Sequence:CCGGCCAGTAGGTATGGATTTGTTTCTCGAGAAACAAATCCATACCTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182550.1-1344s1c1
Sequence:CCGGCCAAGGGTTGTCAGTGATTAACTCGAGTTAATCACTGACAACCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182550
LINC00612 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 612
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000183819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182550.1-1089s1c1
Sequence:CCGGCCAGTAGGTATGGATTTGTTTCTCGAGAAACAAATCCATACCTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182550.1-1344s1c1
Sequence:CCGGCCAAGGGTTGTCAGTGATTAACTCGAGTTAATCACTGACAACCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182550
LINC00612 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 612
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000183819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182550.1-1089s1c1
Sequence:CCGGCCAGTAGGTATGGATTTGTTTCTCGAGAAACAAATCCATACCTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182550.1-1344s1c1
Sequence:CCGGCCAAGGGTTGTCAGTGATTAACTCGAGTTAATCACTGACAACCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)