EMAIL THIS PAGE TO A FRIEND

LINC00632

long intergenic non-protein coding RNA 632

20 Gene Product Result for
Species: Human LINC00632(286411)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001126492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126492 Rosetta Predictions human pricing
XM_932619 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328497 predicted 317
2 SASI_Hs02_00328498 predicted 728
3 SASI_Hs02_00328499 predicted 560
4 SASI_Hs02_00328500 predicted 326
5 SASI_Hs02_00328501 predicted 754
6 SASI_Hs02_00328502 predicted 694
7 SASI_Hs02_00328503 predicted 564
8 SASI_Hs02_00328504 predicted 400
9 SASI_Hs02_00328505 predicted 522
10 SASI_Hs02_00328506 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275292 predicted 393
2 SASI_Hs01_00275293 predicted 472
3 SASI_Hs01_00275294 predicted 324
4 SASI_Hs01_00275295 predicted 713
5 SASI_Hs01_00275296 predicted 470
6 SASI_Hs01_00275297 predicted 705
7 SASI_Hs01_00275298 predicted 294
8 SASI_Hs01_00275299 predicted 676
9 SASI_Hs01_00275300 predicted 327
10 SASI_Hs01_00275301 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126492
LINC00632 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 632
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-219s21c1
Sequence:CCGGAGTACACAGACATATCCAAAGCTCGAGCTTTGGATATGTCTGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-137s21c1
Sequence:CCGGATGCACACACTGACCAGATAACTCGAGTTATCTGGTCAGTGTGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-323s21c1
Sequence:CCGGGGCACGTATGTACTGCTTAATCTCGAGATTAAGCAGTACATACGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126492.1-971s21c1
Sequence:CCGGACGGTACATCTTACAACATATCTCGAGATATGTTGTAAGATGTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126492
LINC00632 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 632
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-219s21c1
Sequence:CCGGAGTACACAGACATATCCAAAGCTCGAGCTTTGGATATGTCTGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-137s21c1
Sequence:CCGGATGCACACACTGACCAGATAACTCGAGTTATCTGGTCAGTGTGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-323s21c1
Sequence:CCGGGGCACGTATGTACTGCTTAATCTCGAGATTAAGCAGTACATACGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126492.1-971s21c1
Sequence:CCGGACGGTACATCTTACAACATATCTCGAGATATGTTGTAAGATGTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126492
LINC00632 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 632
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-219s21c1
Sequence:CCGGAGTACACAGACATATCCAAAGCTCGAGCTTTGGATATGTCTGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-137s21c1
Sequence:CCGGATGCACACACTGACCAGATAACTCGAGTTATCTGGTCAGTGTGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126492.1-323s21c1
Sequence:CCGGGGCACGTATGTACTGCTTAATCTCGAGATTAAGCAGTACATACGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126492.1-971s21c1
Sequence:CCGGACGGTACATCTTACAACATATCTCGAGATATGTTGTAAGATGTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)