EMAIL THIS PAGE TO A FRIEND

LINC00650

long intergenic non-protein coding RNA 650

4 Gene Product Result for
Species: Human LINC00650(400863)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207472 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184012 predicted 2114
2 SASI_Hs01_00184013 predicted 2158
3 SASI_Hs01_00184014 predicted 2163
4 SASI_Hs01_00184015 predicted 2161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207472
LINC00650 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 650
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207472.1-1157s1c1
Sequence:CCGGCCTGCAATTCCCAAATAAGCTCTCGAGAGCTTATTTGGGAATTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207472.1-1544s1c1
Sequence:CCGGCCTTCCAAAGACATGCAGAATCTCGAGATTCTGCATGTCTTTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1341s1c1
Sequence:CCGGCTAAGAGGCATCTCAGACTTACTCGAGTAAGTCTGAGATGCCTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207472.1-1847s1c1
Sequence:CCGGGCCTTTCTGACCATCCTCATTCTCGAGAATGAGGATGGTCAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1323s1c1
Sequence:CCGGGTACCTCTATTTGAACCACTACTCGAGTAGTGGTTCAAATAGAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1161s1c1
Sequence:CCGGCAATTCCCAAATAAGCTCCTTCTCGAGAAGGAGCTTATTTGGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207472
LINC00650 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 650
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207472.1-1157s1c1
Sequence:CCGGCCTGCAATTCCCAAATAAGCTCTCGAGAGCTTATTTGGGAATTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207472.1-1544s1c1
Sequence:CCGGCCTTCCAAAGACATGCAGAATCTCGAGATTCTGCATGTCTTTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1341s1c1
Sequence:CCGGCTAAGAGGCATCTCAGACTTACTCGAGTAAGTCTGAGATGCCTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207472.1-1847s1c1
Sequence:CCGGGCCTTTCTGACCATCCTCATTCTCGAGAATGAGGATGGTCAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1323s1c1
Sequence:CCGGGTACCTCTATTTGAACCACTACTCGAGTAGTGGTTCAAATAGAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1161s1c1
Sequence:CCGGCAATTCCCAAATAAGCTCCTTCTCGAGAAGGAGCTTATTTGGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207472
LINC00650 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 650
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207472.1-1157s1c1
Sequence:CCGGCCTGCAATTCCCAAATAAGCTCTCGAGAGCTTATTTGGGAATTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207472.1-1544s1c1
Sequence:CCGGCCTTCCAAAGACATGCAGAATCTCGAGATTCTGCATGTCTTTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1341s1c1
Sequence:CCGGCTAAGAGGCATCTCAGACTTACTCGAGTAAGTCTGAGATGCCTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207472.1-1847s1c1
Sequence:CCGGGCCTTTCTGACCATCCTCATTCTCGAGAATGAGGATGGTCAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1323s1c1
Sequence:CCGGGTACCTCTATTTGAACCACTACTCGAGTAGTGGTTCAAATAGAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207472.1-1161s1c1
Sequence:CCGGCAATTCCCAAATAAGCTCCTTCTCGAGAAGGAGCTTATTTGGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)