EMAIL THIS PAGE TO A FRIEND

LINC00656

long intergenic non-protein coding RNA 656

42 Gene Product Result for
Species: Human LINC00656(200261)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182535 Rosetta Predictions human pricing
XR_041194 Rosetta Predictions human pricing
XR_041195 Rosetta Predictions human pricing
XR_041196 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066437 predicted 815
2 SASI_Hs01_00066438 predicted 938
3 SASI_Hs01_00066439 predicted 988
4 SASI_Hs01_00066440 predicted 1027
5 SASI_Hs01_00066441 predicted 863
6 SASI_Hs01_00066442 predicted 1158
7 SASI_Hs01_00066443 predicted 1133
8 SASI_Hs01_00066444 predicted 851
9 SASI_Hs01_00066445 predicted 1106
10 SASI_Hs01_00066446 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525432 predicted 46
2 SASI_Hs02_00525433 predicted 129
3 SASI_Hs02_00525434 predicted 250
4 SASI_Hs02_00525435 predicted 181
5 SASI_Hs02_00525436 predicted 46
6 SASI_Hs02_00525437 predicted 124
7 SASI_Hs02_00525438 predicted 123
8 SASI_Hs02_00525439 predicted 186
9 SASI_Hs02_00525440 predicted 237
10 SASI_Hs02_00525441 predicted 48
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525442 predicted 46
2 SASI_Hs02_00525443 predicted 127
3 SASI_Hs02_00525444 predicted 250
4 SASI_Hs02_00525445 predicted 44
5 SASI_Hs02_00525446 predicted 127
6 SASI_Hs02_00525447 predicted 119
7 SASI_Hs02_00525448 predicted 239
8 SASI_Hs02_00525449 predicted 44
9 SASI_Hs02_00525450 predicted 152
10 SASI_Hs02_00525451 predicted 123
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525452 predicted 48
2 SASI_Hs02_00525453 predicted 128
3 SASI_Hs02_00525454 predicted 245
4 SASI_Hs02_00525455 predicted 47
5 SASI_Hs02_00525456 predicted 123
6 SASI_Hs02_00525457 predicted 122
7 SASI_Hs02_00525458 predicted 235
8 SASI_Hs02_00525459 predicted 44
9 SASI_Hs02_00525460 predicted 159
10 SASI_Hs02_00525461 predicted 121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182535
LINC00656 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 656
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-819s1c1
Sequence:CCGGCCTCAGAGCTTCTCATCAGTACTCGAGTACTGATGAGAAGCTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-749s1c1
Sequence:CCGGGACAGTCATAGAACTGGCCTTCTCGAGAAGGCCAGTTCTATGACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-941s1c1
Sequence:CCGGCTATCACAATGGTGTCCCTTTCTCGAGAAAGGGACACCATTGTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1706s1c1
Sequence:CCGGCCTGGTGCAAAGTAAGCACAACTCGAGTTGTGCTTACTTTGCACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-824s1c1
Sequence:CCGGGAGCTTCTCATCAGTAACCCACTCGAGTGGGTTACTGATGAGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1393s1c1
Sequence:CCGGCCTTCTTAAATGAAACACCTTCTCGAGAAGGTGTTTCATTTAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1162s1c1
Sequence:CCGGGCAATCTCACAGATGTTCTAACTCGAGTTAGAACATCTGTGAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1103s1c1
Sequence:CCGGGCCTTGAGAAATCCCAGCTTACTCGAGTAAGCTGGGATTTCTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-940s1c1
Sequence:CCGGGCTATCACAATGGTGTCCCTTCTCGAGAAGGGACACCATTGTGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182535
LINC00656 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 656
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-819s1c1
Sequence:CCGGCCTCAGAGCTTCTCATCAGTACTCGAGTACTGATGAGAAGCTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-749s1c1
Sequence:CCGGGACAGTCATAGAACTGGCCTTCTCGAGAAGGCCAGTTCTATGACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-941s1c1
Sequence:CCGGCTATCACAATGGTGTCCCTTTCTCGAGAAAGGGACACCATTGTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1706s1c1
Sequence:CCGGCCTGGTGCAAAGTAAGCACAACTCGAGTTGTGCTTACTTTGCACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-824s1c1
Sequence:CCGGGAGCTTCTCATCAGTAACCCACTCGAGTGGGTTACTGATGAGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1393s1c1
Sequence:CCGGCCTTCTTAAATGAAACACCTTCTCGAGAAGGTGTTTCATTTAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1162s1c1
Sequence:CCGGGCAATCTCACAGATGTTCTAACTCGAGTTAGAACATCTGTGAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1103s1c1
Sequence:CCGGGCCTTGAGAAATCCCAGCTTACTCGAGTAAGCTGGGATTTCTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-940s1c1
Sequence:CCGGGCTATCACAATGGTGTCCCTTCTCGAGAAGGGACACCATTGTGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182535
LINC00656 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 656
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-819s1c1
Sequence:CCGGCCTCAGAGCTTCTCATCAGTACTCGAGTACTGATGAGAAGCTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-749s1c1
Sequence:CCGGGACAGTCATAGAACTGGCCTTCTCGAGAAGGCCAGTTCTATGACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-941s1c1
Sequence:CCGGCTATCACAATGGTGTCCCTTTCTCGAGAAAGGGACACCATTGTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1706s1c1
Sequence:CCGGCCTGGTGCAAAGTAAGCACAACTCGAGTTGTGCTTACTTTGCACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-824s1c1
Sequence:CCGGGAGCTTCTCATCAGTAACCCACTCGAGTGGGTTACTGATGAGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1393s1c1
Sequence:CCGGCCTTCTTAAATGAAACACCTTCTCGAGAAGGTGTTTCATTTAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1162s1c1
Sequence:CCGGGCAATCTCACAGATGTTCTAACTCGAGTTAGAACATCTGTGAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182535.1-1103s1c1
Sequence:CCGGGCCTTGAGAAATCCCAGCTTACTCGAGTAAGCTGGGATTTCTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182535.1-940s1c1
Sequence:CCGGGCTATCACAATGGTGTCCCTTCTCGAGAAGGGACACCATTGTGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)