EMAIL THIS PAGE TO A FRIEND

LINC00661

long intergenic non-protein coding RNA 661

239 Gene Product Result for
Species: Human LINC00661(126536)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034966 Rosetta Predictions human pricing
XR_041168 Rosetta Predictions human pricing
XR_041169 Rosetta Predictions human pricing
XR_041170 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027366 predicted 1940
2 SASI_Hs01_00027367 predicted 1350
3 SASI_Hs01_00027368 predicted 2017
4 SASI_Hs01_00027369 predicted 1313
5 SASI_Hs01_00027370 predicted 1864
6 SASI_Hs01_00027371 predicted 2100
7 SASI_Hs01_00027372 predicted 1430
8 SASI_Hs01_00027373 predicted 2064
9 SASI_Hs01_00027374 predicted 1830
10 SASI_Hs01_00027375 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525228 predicted 215
2 SASI_Hs02_00525229 predicted 223
3 SASI_Hs02_00525230 predicted 287
4 SASI_Hs02_00525231 predicted 215
5 SASI_Hs02_00525232 predicted 228
6 SASI_Hs02_00525233 predicted 229
7 SASI_Hs02_00525234 predicted 240
8 SASI_Hs02_00525235 predicted 251
9 SASI_Hs02_00525236 predicted 212
10 SASI_Hs02_00525237 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525238 predicted 216
2 SASI_Hs02_00525239 predicted 226
3 SASI_Hs02_00525240 predicted 295
4 SASI_Hs02_00525241 predicted 213
5 SASI_Hs02_00525242 predicted 224
6 SASI_Hs02_00525243 predicted 236
7 SASI_Hs02_00525244 predicted 235
8 SASI_Hs02_00525245 predicted 247
9 SASI_Hs02_00525246 predicted 219
10 SASI_Hs02_00525247 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525248 predicted 212
2 SASI_Hs02_00525249 predicted 221
3 SASI_Hs02_00525250 predicted 293
4 SASI_Hs02_00525251 predicted 215
5 SASI_Hs02_00525252 predicted 228
6 SASI_Hs02_00525253 predicted 233
7 SASI_Hs02_00525254 predicted 240
8 SASI_Hs02_00525255 predicted 249
9 SASI_Hs02_00525256 predicted 216
10 SASI_Hs02_00525257 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034966
LINC00661 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 661
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1570s1c1
Sequence:CCGGCATCTGTGCAGTGCAAGTGATCTCGAGATCACTTGCACTGCACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1289s1c1
Sequence:CCGGCCTCTGACTCAACCTATGAGACTCGAGTCTCATAGGTTGAGTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1301s1c1
Sequence:CCGGCCTATGAGACAGAGCTCTGATCTCGAGATCAGAGCTCTGTCTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2015s1c1
Sequence:CCGGGCACACTTTGTAGACTTCAAACTCGAGTTTGAAGTCTACAAAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-1942s1c1
Sequence:CCGGCCACCGTTATAAATTTGAGATCTCGAGATCTCAAATTTATAACGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2382s1c1
Sequence:CCGGGCAACGCTCATCTCTAATAATCTCGAGATTATTAGAGATGAGCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1438s1c1
Sequence:CCGGCTCATTGGAGAATCCAGGCAACTCGAGTTGCCTGGATTCTCCAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1423s1c1
Sequence:CCGGCTGGGCACTGTACTTCTCATTCTCGAGAATGAGAAGTACAGTGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1456s1c1
Sequence:CCGGCAAGATCTTGAAGCAGGTGCACTCGAGTGCACCTGCTTCAAGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2211s1c1
Sequence:CCGGCCTTCCAGTAAGCTGCAACTTCTCGAGAAGTTGCAGCTTACTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1428s1c1
Sequence:CCGGCACTGTACTTCTCATTGGAGACTCGAGTCTCCAATGAGAAGTACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1440s1c1
Sequence:CCGGCATTGGAGAATCCAGGCAAGACTCGAGTCTTGCCTGGATTCTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2898s1c1
Sequence:CCGGGCGATGGTCATACAGAAGTAACTCGAGTTACTTCTGTATGACCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034966
LINC00661 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 661
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1570s1c1
Sequence:CCGGCATCTGTGCAGTGCAAGTGATCTCGAGATCACTTGCACTGCACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1289s1c1
Sequence:CCGGCCTCTGACTCAACCTATGAGACTCGAGTCTCATAGGTTGAGTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1301s1c1
Sequence:CCGGCCTATGAGACAGAGCTCTGATCTCGAGATCAGAGCTCTGTCTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2015s1c1
Sequence:CCGGGCACACTTTGTAGACTTCAAACTCGAGTTTGAAGTCTACAAAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-1942s1c1
Sequence:CCGGCCACCGTTATAAATTTGAGATCTCGAGATCTCAAATTTATAACGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2382s1c1
Sequence:CCGGGCAACGCTCATCTCTAATAATCTCGAGATTATTAGAGATGAGCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1438s1c1
Sequence:CCGGCTCATTGGAGAATCCAGGCAACTCGAGTTGCCTGGATTCTCCAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1423s1c1
Sequence:CCGGCTGGGCACTGTACTTCTCATTCTCGAGAATGAGAAGTACAGTGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1456s1c1
Sequence:CCGGCAAGATCTTGAAGCAGGTGCACTCGAGTGCACCTGCTTCAAGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2211s1c1
Sequence:CCGGCCTTCCAGTAAGCTGCAACTTCTCGAGAAGTTGCAGCTTACTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1428s1c1
Sequence:CCGGCACTGTACTTCTCATTGGAGACTCGAGTCTCCAATGAGAAGTACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1440s1c1
Sequence:CCGGCATTGGAGAATCCAGGCAAGACTCGAGTCTTGCCTGGATTCTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2898s1c1
Sequence:CCGGGCGATGGTCATACAGAAGTAACTCGAGTTACTTCTGTATGACCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034966
LINC00661 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 661
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1570s1c1
Sequence:CCGGCATCTGTGCAGTGCAAGTGATCTCGAGATCACTTGCACTGCACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1289s1c1
Sequence:CCGGCCTCTGACTCAACCTATGAGACTCGAGTCTCATAGGTTGAGTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1301s1c1
Sequence:CCGGCCTATGAGACAGAGCTCTGATCTCGAGATCAGAGCTCTGTCTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2015s1c1
Sequence:CCGGGCACACTTTGTAGACTTCAAACTCGAGTTTGAAGTCTACAAAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-1942s1c1
Sequence:CCGGCCACCGTTATAAATTTGAGATCTCGAGATCTCAAATTTATAACGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2382s1c1
Sequence:CCGGGCAACGCTCATCTCTAATAATCTCGAGATTATTAGAGATGAGCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1438s1c1
Sequence:CCGGCTCATTGGAGAATCCAGGCAACTCGAGTTGCCTGGATTCTCCAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1423s1c1
Sequence:CCGGCTGGGCACTGTACTTCTCATTCTCGAGAATGAGAAGTACAGTGCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1456s1c1
Sequence:CCGGCAAGATCTTGAAGCAGGTGCACTCGAGTGCACCTGCTTCAAGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2211s1c1
Sequence:CCGGCCTTCCAGTAAGCTGCAACTTCTCGAGAAGTTGCAGCTTACTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1428s1c1
Sequence:CCGGCACTGTACTTCTCATTGGAGACTCGAGTCTCCAATGAGAAGTACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034966.1-1440s1c1
Sequence:CCGGCATTGGAGAATCCAGGCAAGACTCGAGTCTTGCCTGGATTCTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034966.1-2898s1c1
Sequence:CCGGGCGATGGTCATACAGAAGTAACTCGAGTTACTTCTGTATGACCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)