EMAIL THIS PAGE TO A FRIEND

LINC00663

long intergenic non-protein coding RNA 663

32 Gene Product Result for
Species: Human LINC00663(284440)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182576 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041448 Rosetta Predictions human pricing
XR_041449 Rosetta Predictions human pricing
XR_041450 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527469 predicted 15
2 SASI_Hs02_00527470 predicted 5
3 SASI_Hs02_00527471 predicted 278
4 SASI_Hs02_00527472 predicted 200
5 SASI_Hs02_00527473 predicted 211
6 SASI_Hs02_00527474 predicted 204
7 SASI_Hs02_00527475 predicted 245
8 SASI_Hs02_00527476 predicted 309
9 SASI_Hs02_00527477 predicted 277
10 SASI_Hs02_00527478 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527479 predicted 8
2 SASI_Hs02_00527480 predicted 12
3 SASI_Hs02_00527481 predicted 275
4 SASI_Hs02_00527482 predicted 204
5 SASI_Hs02_00527483 predicted 206
6 SASI_Hs02_00527484 predicted 204
7 SASI_Hs02_00527485 predicted 243
8 SASI_Hs02_00527486 predicted 314
9 SASI_Hs02_00527487 predicted 279
10 SASI_Hs02_00527488 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527489 predicted 12
2 SASI_Hs02_00527490 predicted 10
3 SASI_Hs02_00527491 predicted 279
4 SASI_Hs02_00527492 predicted 201
5 SASI_Hs02_00527493 predicted 208
6 SASI_Hs02_00527494 predicted 202
7 SASI_Hs02_00527495 predicted 244
8 SASI_Hs02_00527496 predicted 312
9 SASI_Hs02_00527497 predicted 271
10 SASI_Hs02_00527498 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182576
LINC00663 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 663
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-629s1c1
Sequence:CCGGGCGATGATGACCGTAATGAAACTCGAGTTTCATTACGGTCATCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-714s1c1
Sequence:CCGGCTTTGATGGTTCAGTGGACCTCTCGAGAGGTCCACTGAACCATCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-725s1c1
Sequence:CCGGCAGTGGACCTGCACTACAATTCTCGAGAATTGTAGTGCAGGTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-581s1c1
Sequence:CCGGGCAGTCATCACCTCAGCAATTCTCGAGAATTGCTGAGGTGATGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-968s1c1
Sequence:CCGGCCTGACATCATAATGGTAGATCTCGAGATCTACCATTATGATGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-1289s1c1
Sequence:CCGGCCCATTGTATCTTGGAAGTAACTCGAGTTACTTCCAAGATACAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-1354s1c1
Sequence:CCGGGCGTTGTCTCAGATAAGACTTCTCGAGAAGTCTTATCTGAGACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-746s1c1
Sequence:CCGGGCAGTGCAAAGTGCAAGAGTTCTCGAGAACTCTTGCACTTTGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-730s1c1
Sequence:CCGGGACCTGCACTACAATTGCAGTCTCGAGACTGCAATTGTAGTGCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182576
LINC00663 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 663
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-629s1c1
Sequence:CCGGGCGATGATGACCGTAATGAAACTCGAGTTTCATTACGGTCATCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-714s1c1
Sequence:CCGGCTTTGATGGTTCAGTGGACCTCTCGAGAGGTCCACTGAACCATCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-725s1c1
Sequence:CCGGCAGTGGACCTGCACTACAATTCTCGAGAATTGTAGTGCAGGTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-581s1c1
Sequence:CCGGGCAGTCATCACCTCAGCAATTCTCGAGAATTGCTGAGGTGATGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-968s1c1
Sequence:CCGGCCTGACATCATAATGGTAGATCTCGAGATCTACCATTATGATGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-1289s1c1
Sequence:CCGGCCCATTGTATCTTGGAAGTAACTCGAGTTACTTCCAAGATACAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-1354s1c1
Sequence:CCGGGCGTTGTCTCAGATAAGACTTCTCGAGAAGTCTTATCTGAGACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-746s1c1
Sequence:CCGGGCAGTGCAAAGTGCAAGAGTTCTCGAGAACTCTTGCACTTTGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-730s1c1
Sequence:CCGGGACCTGCACTACAATTGCAGTCTCGAGACTGCAATTGTAGTGCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182576
LINC00663 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 663
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-629s1c1
Sequence:CCGGGCGATGATGACCGTAATGAAACTCGAGTTTCATTACGGTCATCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-714s1c1
Sequence:CCGGCTTTGATGGTTCAGTGGACCTCTCGAGAGGTCCACTGAACCATCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-725s1c1
Sequence:CCGGCAGTGGACCTGCACTACAATTCTCGAGAATTGTAGTGCAGGTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-581s1c1
Sequence:CCGGGCAGTCATCACCTCAGCAATTCTCGAGAATTGCTGAGGTGATGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-968s1c1
Sequence:CCGGCCTGACATCATAATGGTAGATCTCGAGATCTACCATTATGATGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-1289s1c1
Sequence:CCGGCCCATTGTATCTTGGAAGTAACTCGAGTTACTTCCAAGATACAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182576.1-1354s1c1
Sequence:CCGGGCGTTGTCTCAGATAAGACTTCTCGAGAAGTCTTATCTGAGACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-746s1c1
Sequence:CCGGGCAGTGCAAAGTGCAAGAGTTCTCGAGAACTCTTGCACTTTGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182576.1-730s1c1
Sequence:CCGGGACCTGCACTACAATTGCAGTCTCGAGACTGCAATTGTAGTGCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)