EMAIL THIS PAGE TO A FRIEND

LINC00670

long intergenic non-protein coding RNA 670

Gene Product Result for
Species: Human LINC00670(284034)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182567
LINC00670 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 670
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-157s1c1
Sequence:CCGGGAGAAGCATCTGCAACCACAACTCGAGTTGTGGTTGCAGATGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-399s1c1
Sequence:CCGGGCTCGTCATACAGAAGAGTGTCTCGAGACACTCTTCTGTATGACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-469s1c1
Sequence:CCGGCAAGGAGCTGAGAGGTGAAATCTCGAGATTTCACCTCTCAGCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-264s1c1
Sequence:CCGGCTGCAAATGCTGCACATCTTTCTCGAGAAAGATGTGCAGCATTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-478s1c1
Sequence:CCGGGAGAGGTGAAATTCGGACATTCTCGAGAATGTCCGAATTTCACCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182567.1-2294s1c1
Sequence:CCGGCCACTTCTTTATGTGGTTGTTCTCGAGAACAACCACATAAAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182567.1-1596s1c1
Sequence:CCGGCCCATTAGTTACGTCTTTCTTCTCGAGAAGAAAGACGTAACTAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-344s1c1
Sequence:CCGGGAAGGGTTGTCATTTGCCATACTCGAGTATGGCAAATGACAACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-151s1c1
Sequence:CCGGGAAACTGAGAAGCATCTGCAACTCGAGTTGCAGATGCTTCTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182567
LINC00670 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 670
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-157s1c1
Sequence:CCGGGAGAAGCATCTGCAACCACAACTCGAGTTGTGGTTGCAGATGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-399s1c1
Sequence:CCGGGCTCGTCATACAGAAGAGTGTCTCGAGACACTCTTCTGTATGACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-469s1c1
Sequence:CCGGCAAGGAGCTGAGAGGTGAAATCTCGAGATTTCACCTCTCAGCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-264s1c1
Sequence:CCGGCTGCAAATGCTGCACATCTTTCTCGAGAAAGATGTGCAGCATTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-478s1c1
Sequence:CCGGGAGAGGTGAAATTCGGACATTCTCGAGAATGTCCGAATTTCACCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182567.1-2294s1c1
Sequence:CCGGCCACTTCTTTATGTGGTTGTTCTCGAGAACAACCACATAAAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182567.1-1596s1c1
Sequence:CCGGCCCATTAGTTACGTCTTTCTTCTCGAGAAGAAAGACGTAACTAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-344s1c1
Sequence:CCGGGAAGGGTTGTCATTTGCCATACTCGAGTATGGCAAATGACAACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-151s1c1
Sequence:CCGGGAAACTGAGAAGCATCTGCAACTCGAGTTGCAGATGCTTCTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182567
LINC00670 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 670
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-157s1c1
Sequence:CCGGGAGAAGCATCTGCAACCACAACTCGAGTTGTGGTTGCAGATGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-399s1c1
Sequence:CCGGGCTCGTCATACAGAAGAGTGTCTCGAGACACTCTTCTGTATGACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-469s1c1
Sequence:CCGGCAAGGAGCTGAGAGGTGAAATCTCGAGATTTCACCTCTCAGCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-264s1c1
Sequence:CCGGCTGCAAATGCTGCACATCTTTCTCGAGAAAGATGTGCAGCATTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182567.1-478s1c1
Sequence:CCGGGAGAGGTGAAATTCGGACATTCTCGAGAATGTCCGAATTTCACCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182567.1-2294s1c1
Sequence:CCGGCCACTTCTTTATGTGGTTGTTCTCGAGAACAACCACATAAAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182567.1-1596s1c1
Sequence:CCGGCCCATTAGTTACGTCTTTCTTCTCGAGAAGAAAGACGTAACTAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-344s1c1
Sequence:CCGGGAAGGGTTGTCATTTGCCATACTCGAGTATGGCAAATGACAACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182567.1-151s1c1
Sequence:CCGGGAAACTGAGAAGCATCTGCAACTCGAGTTGCAGATGCTTCTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)