EMAIL THIS PAGE TO A FRIEND

LINC00671

long intergenic non-protein coding RNA 671

42 Gene Product Result for
Species: Human LINC00671(388387)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207388 Rosetta Predictions human pricing
XR_041466 Rosetta Predictions human pricing
XR_041467 Rosetta Predictions human pricing
XR_041468 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010986 predicted 641
2 SASI_Hs01_00010987 predicted 605
3 SASI_Hs01_00010988 predicted 599
4 SASI_Hs01_00010989 predicted 551
5 SASI_Hs01_00010990 predicted 622
6 SASI_Hs01_00010991 predicted 754
7 SASI_Hs01_00010992 predicted 614
8 SASI_Hs01_00010993 predicted 718
9 SASI_Hs01_00010994 predicted 681
10 SASI_Hs01_00010995 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527599 predicted 43
2 SASI_Hs02_00527600 predicted 30
3 SASI_Hs02_00527601 predicted 140
4 SASI_Hs02_00527602 predicted 102
5 SASI_Hs02_00527603 predicted 201
6 SASI_Hs02_00527604 predicted 83
7 SASI_Hs02_00527605 predicted 64
8 SASI_Hs02_00527606 predicted 99
9 SASI_Hs02_00527607 predicted 104
10 SASI_Hs02_00527608 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527609 predicted 36
2 SASI_Hs02_00527610 predicted 27
3 SASI_Hs02_00527611 predicted 146
4 SASI_Hs02_00527612 predicted 97
5 SASI_Hs02_00527613 predicted 200
6 SASI_Hs02_00527614 predicted 88
7 SASI_Hs02_00527615 predicted 65
8 SASI_Hs02_00527616 predicted 96
9 SASI_Hs02_00527617 predicted 104
10 SASI_Hs02_00527618 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527619 predicted 39
2 SASI_Hs02_00527620 predicted 34
3 SASI_Hs02_00527621 predicted 148
4 SASI_Hs02_00527622 predicted 103
5 SASI_Hs02_00527623 predicted 202
6 SASI_Hs02_00527624 predicted 89
7 SASI_Hs02_00527625 predicted 67
8 SASI_Hs02_00527626 predicted 94
9 SASI_Hs02_00527627 predicted 100
10 SASI_Hs02_00527628 predicted 195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207388
LINC00671 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 671
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-314s1c1
Sequence:CCGGGAGGAAGTGTTTCATGGTGGACTCGAGTCCACCATGAAACACTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-302s1c1
Sequence:CCGGCAGTGATCAATGGAGGAAGTGCTCGAGCACTTCCTCCATTGATCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-354s1c1
Sequence:CCGGCAACTGCTGTCACCTTCTAAGCTCGAGCTTAGAAGGTGACAGCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-575s1c1
Sequence:CCGGCCCAGGAAGTTTACCAGATTTCTCGAGAAATCTGGTAAACTTCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-292s1c1
Sequence:CCGGGCTGGGATTACAGTGATCAATCTCGAGATTGATCACTGTAATCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207388.1-653s1c1
Sequence:CCGGGCTTCTTTCTTGAAGGTGGAACTCGAGTTCCACCTTCAAGAAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-317s1c1
Sequence:CCGGGAAGTGTTTCATGGTGGACATCTCGAGATGTCCACCATGAAACACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207388.1-1328s1c1
Sequence:CCGGCCACGGCTTTAGTCCTTGTATCTCGAGATACAAGGACTAAAGCCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-351s1c1
Sequence:CCGGGATCAACTGCTGTCACCTTCTCTCGAGAGAAGGTGACAGCAGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-349s1c1
Sequence:CCGGCAGATCAACTGCTGTCACCTTCTCGAGAAGGTGACAGCAGTTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207388
LINC00671 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 671
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-314s1c1
Sequence:CCGGGAGGAAGTGTTTCATGGTGGACTCGAGTCCACCATGAAACACTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-302s1c1
Sequence:CCGGCAGTGATCAATGGAGGAAGTGCTCGAGCACTTCCTCCATTGATCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-354s1c1
Sequence:CCGGCAACTGCTGTCACCTTCTAAGCTCGAGCTTAGAAGGTGACAGCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-575s1c1
Sequence:CCGGCCCAGGAAGTTTACCAGATTTCTCGAGAAATCTGGTAAACTTCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-292s1c1
Sequence:CCGGGCTGGGATTACAGTGATCAATCTCGAGATTGATCACTGTAATCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207388.1-653s1c1
Sequence:CCGGGCTTCTTTCTTGAAGGTGGAACTCGAGTTCCACCTTCAAGAAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-317s1c1
Sequence:CCGGGAAGTGTTTCATGGTGGACATCTCGAGATGTCCACCATGAAACACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207388.1-1328s1c1
Sequence:CCGGCCACGGCTTTAGTCCTTGTATCTCGAGATACAAGGACTAAAGCCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-351s1c1
Sequence:CCGGGATCAACTGCTGTCACCTTCTCTCGAGAGAAGGTGACAGCAGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-349s1c1
Sequence:CCGGCAGATCAACTGCTGTCACCTTCTCGAGAAGGTGACAGCAGTTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207388
LINC00671 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 671
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-314s1c1
Sequence:CCGGGAGGAAGTGTTTCATGGTGGACTCGAGTCCACCATGAAACACTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-302s1c1
Sequence:CCGGCAGTGATCAATGGAGGAAGTGCTCGAGCACTTCCTCCATTGATCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-354s1c1
Sequence:CCGGCAACTGCTGTCACCTTCTAAGCTCGAGCTTAGAAGGTGACAGCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-575s1c1
Sequence:CCGGCCCAGGAAGTTTACCAGATTTCTCGAGAAATCTGGTAAACTTCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-292s1c1
Sequence:CCGGGCTGGGATTACAGTGATCAATCTCGAGATTGATCACTGTAATCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207388.1-653s1c1
Sequence:CCGGGCTTCTTTCTTGAAGGTGGAACTCGAGTTCCACCTTCAAGAAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-317s1c1
Sequence:CCGGGAAGTGTTTCATGGTGGACATCTCGAGATGTCCACCATGAAACACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207388.1-1328s1c1
Sequence:CCGGCCACGGCTTTAGTCCTTGTATCTCGAGATACAAGGACTAAAGCCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-351s1c1
Sequence:CCGGGATCAACTGCTGTCACCTTCTCTCGAGAGAAGGTGACAGCAGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207388.1-349s1c1
Sequence:CCGGCAGATCAACTGCTGTCACCTTCTCGAGAAGGTGACAGCAGTTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)