EMAIL THIS PAGE TO A FRIEND

LINC00696

long intergenic non-protein coding RNA 696

13 Gene Product Result for
Synonyms: C3orf74
UniProtKB ID: Q6ZRV3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123039 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123039 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327657 predicted 1851
2 SASI_Hs02_00327658 predicted 1823
3 SASI_Hs02_00327659 predicted 1783
4 SASI_Hs02_00327660 predicted 1815
5 SASI_Hs02_00327661 predicted 1779
6 SASI_Hs02_00327662 predicted 1726
7 SASI_Hs02_00327663 predicted 1746
8 SASI_Hs02_00327664 predicted 1849
9 SASI_Hs02_00327665 predicted 1814
10 SASI_Hs02_00327666 predicted 1793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123039
LINC00696 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 696
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123039.1-2196s21c1
Sequence:CCGGGGAGTGTGCAAGCCCATTAAGCTCGAGCTTAATGGGCTTGCACACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1769s21c1
Sequence:CCGGATTGAGTACTGGGATGGATTACTCGAGTAATCCATCCCAGTACTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1957s21c1
Sequence:CCGGCTCCCTGTGGACTGTACTTGACTCGAGTCAAGTACAGTCCACAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1846s21c1
Sequence:CCGGGACAGAGCCCTTCTCTTTATGCTCGAGCATAAAGAGAAGGGCTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1815s21c1
Sequence:CCGGAGGCGTTTGGTAGCACGAATGCTCGAGCATTCGTGCTACCAAACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123039
LINC00696 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 696
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123039.1-2196s21c1
Sequence:CCGGGGAGTGTGCAAGCCCATTAAGCTCGAGCTTAATGGGCTTGCACACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1769s21c1
Sequence:CCGGATTGAGTACTGGGATGGATTACTCGAGTAATCCATCCCAGTACTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1957s21c1
Sequence:CCGGCTCCCTGTGGACTGTACTTGACTCGAGTCAAGTACAGTCCACAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1846s21c1
Sequence:CCGGGACAGAGCCCTTCTCTTTATGCTCGAGCATAAAGAGAAGGGCTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1815s21c1
Sequence:CCGGAGGCGTTTGGTAGCACGAATGCTCGAGCATTCGTGCTACCAAACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123039
LINC00696 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 696
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123039.1-2196s21c1
Sequence:CCGGGGAGTGTGCAAGCCCATTAAGCTCGAGCTTAATGGGCTTGCACACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1769s21c1
Sequence:CCGGATTGAGTACTGGGATGGATTACTCGAGTAATCCATCCCAGTACTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1957s21c1
Sequence:CCGGCTCCCTGTGGACTGTACTTGACTCGAGTCAAGTACAGTCCACAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1846s21c1
Sequence:CCGGGACAGAGCCCTTCTCTTTATGCTCGAGCATAAAGAGAAGGGCTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123039.1-1815s21c1
Sequence:CCGGAGGCGTTTGGTAGCACGAATGCTCGAGCATTCGTGCTACCAAACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)