EMAIL THIS PAGE TO A FRIEND

LINC00852

long intergenic non-protein coding RNA 852

42 Gene Product Result for
Synonyms: C3orf42 GHRL-AS2 GHRLOS2 NAG73
Species: Human LINC00852(84657)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039102 Rosetta Predictions human pricing
XR_040160 Rosetta Predictions human pricing
XR_040161 Rosetta Predictions human pricing
XR_040162 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200747 predicted 635
2 SASI_Hs01_00200748 predicted 793
3 SASI_Hs01_00200749 predicted 557
4 SASI_Hs01_00200750 predicted 643
5 SASI_Hs01_00200751 predicted 593
6 SASI_Hs01_00200752 predicted 786
7 SASI_Hs01_00200753 predicted 685
8 SASI_Hs01_00200754 predicted 682
9 SASI_Hs01_00200755 predicted 781
10 SASI_Hs01_00200756 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516458 predicted 580
2 SASI_Hs02_00516459 predicted 513
3 SASI_Hs02_00516460 predicted 736
4 SASI_Hs02_00516461 predicted 437
5 SASI_Hs02_00516462 predicted 646
6 SASI_Hs02_00516463 predicted 500
7 SASI_Hs02_00516464 predicted 594
8 SASI_Hs02_00516465 predicted 741
9 SASI_Hs02_00516466 predicted 537
10 SASI_Hs02_00516467 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516468 predicted 581
2 SASI_Hs02_00516469 predicted 515
3 SASI_Hs02_00516470 predicted 738
4 SASI_Hs02_00516471 predicted 437
5 SASI_Hs02_00516472 predicted 646
6 SASI_Hs02_00516473 predicted 499
7 SASI_Hs02_00516474 predicted 594
8 SASI_Hs02_00516475 predicted 738
9 SASI_Hs02_00516476 predicted 541
10 SASI_Hs02_00516477 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516478 predicted 581
2 SASI_Hs02_00516479 predicted 516
3 SASI_Hs02_00516480 predicted 738
4 SASI_Hs02_00516481 predicted 435
5 SASI_Hs02_00516482 predicted 638
6 SASI_Hs02_00516483 predicted 501
7 SASI_Hs02_00516484 predicted 589
8 SASI_Hs02_00516485 predicted 741
9 SASI_Hs02_00516486 predicted 536
10 SASI_Hs02_00516487 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032570
LINC00852 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 852
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-799s1c1
Sequence:CCGGCTTAACGTCTAACTTCAGATTCTCGAGAATCTGAAGTTAGACGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-642s1c1
Sequence:CCGGCACCTGGTATCAGTAAGGGAACTCGAGTTCCCTTACTGATACCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-694s1c1
Sequence:CCGGGCATTTGCTTTGTCAGGCCTTCTCGAGAAGGCCTGACAAAGCAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032570
LINC00852 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 852
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-799s1c1
Sequence:CCGGCTTAACGTCTAACTTCAGATTCTCGAGAATCTGAAGTTAGACGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-642s1c1
Sequence:CCGGCACCTGGTATCAGTAAGGGAACTCGAGTTCCCTTACTGATACCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-694s1c1
Sequence:CCGGGCATTTGCTTTGTCAGGCCTTCTCGAGAAGGCCTGACAAAGCAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032570
LINC00852 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 852
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-799s1c1
Sequence:CCGGCTTAACGTCTAACTTCAGATTCTCGAGAATCTGAAGTTAGACGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-642s1c1
Sequence:CCGGCACCTGGTATCAGTAAGGGAACTCGAGTTCCCTTACTGATACCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032570.1-694s1c1
Sequence:CCGGGCATTTGCTTTGTCAGGCCTTCTCGAGAAGGCCTGACAAAGCAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)