EMAIL THIS PAGE TO A FRIEND

LINC00859

long intergenic non-protein coding RNA 859

12 Gene Product Result for
Synonyms: C16orf85
Species: Human LINC00859(400555)
UniProtKB ID: Q6ZSH3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412965 Anti-C16orf85 antibody produced in mouse purified immunoglobulin human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001682 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303879 predicted 3149
2 SASI_Hs01_00074384 predicted 3100
3 SASI_Hs01_00074385 predicted 2871
4 SASI_Hs01_00074386 predicted 2890
5 SASI_Hs01_00074387 predicted 3094
6 SASI_Hs01_00074388 predicted 2953
7 SASI_Hs01_00074389 predicted 2867
8 SASI_Hs01_00074390 predicted 2917
9 SASI_Hs01_00074391 predicted 2878
10 SASI_Hs01_00074392 predicted 2881
11 SASI_Hs01_00074383 predicted 3156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001682
LINC00859 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 859
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2795s1c1
Sequence:CCGGGAGAACAACTTGATTGAAGAGCTCGAGCTCTTCAATCAAGTTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2789s1c1
Sequence:CCGGGTAGAAGAGAACAACTTGATTCTCGAGAATCAAGTTGTTCTCTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2786s1c1
Sequence:CCGGGAGGTAGAAGAGAACAACTTGCTCGAGCAAGTTGTTCTCTTCTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2784s1c1
Sequence:CCGGCGGAGGTAGAAGAGAACAACTCTCGAGAGTTGTTCTCTTCTACCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001682
LINC00859 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 859
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2795s1c1
Sequence:CCGGGAGAACAACTTGATTGAAGAGCTCGAGCTCTTCAATCAAGTTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2789s1c1
Sequence:CCGGGTAGAAGAGAACAACTTGATTCTCGAGAATCAAGTTGTTCTCTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2786s1c1
Sequence:CCGGGAGGTAGAAGAGAACAACTTGCTCGAGCAAGTTGTTCTCTTCTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2784s1c1
Sequence:CCGGCGGAGGTAGAAGAGAACAACTCTCGAGAGTTGTTCTCTTCTACCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001682
LINC00859 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 859
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2795s1c1
Sequence:CCGGGAGAACAACTTGATTGAAGAGCTCGAGCTCTTCAATCAAGTTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2789s1c1
Sequence:CCGGGTAGAAGAGAACAACTTGATTCTCGAGAATCAAGTTGTTCTCTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2786s1c1
Sequence:CCGGGAGGTAGAAGAGAACAACTTGCTCGAGCAAGTTGTTCTCTTCTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001682.1-2784s1c1
Sequence:CCGGCGGAGGTAGAAGAGAACAACTCTCGAGAGTTGTTCTCTTCTACCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)