EMAIL THIS PAGE TO A FRIEND

LINC00885

long intergenic non-protein coding RNA 885

12 Gene Product Result for
Species: Human LINC00885(401109)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101475 predicted 384
2 SASI_Hs01_00101476 predicted 314
3 SASI_Hs01_00101477 predicted 338
4 SASI_Hs01_00101478 predicted 1017
5 SASI_Hs01_00101479 predicted 906
6 SASI_Hs01_00101480 predicted 595
7 SASI_Hs01_00101481 predicted 739
8 SASI_Hs01_00101482 predicted 938
9 SASI_Hs01_00101483 predicted 732
10 SASI_Hs01_00101484 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001699
LINC00885 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 885
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-801s1c1
Sequence:CCGGGCCTCCAAGATAAAGCACCAACTCGAGTTGGTGCTTTATCTTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001699.1-535s1c1
Sequence:CCGGCACGAACTACTTCATCCCTCTCTCGAGAGAGGGATGAAGTAGTTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-1362s1c1
Sequence:CCGGCAAAGACATGAAGACATGAAACTCGAGTTTCATGTCTTCATGTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-1666s1c1
Sequence:CCGGGCTATGAATGACCACACTGATCTCGAGATCAGTGTGGTCATTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-592s1c1
Sequence:CCGGCCTCCCAATTATCTCCTCTTTCTCGAGAAAGAGGAGATAATTGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-932s1c1
Sequence:CCGGCGTGAGTAACTCCATGCTCTTCTCGAGAAGAGCATGGAGTTACTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-854s1c1
Sequence:CCGGCCTCCATTGAAACACGCACATCTCGAGATGTGCGTGTTTCAATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001699.1-260s1c1
Sequence:CCGGCCTGTCTGGCTGATGATTCATCTCGAGATGAATCATCAGCCAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001699
LINC00885 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 885
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-801s1c1
Sequence:CCGGGCCTCCAAGATAAAGCACCAACTCGAGTTGGTGCTTTATCTTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001699.1-535s1c1
Sequence:CCGGCACGAACTACTTCATCCCTCTCTCGAGAGAGGGATGAAGTAGTTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-1362s1c1
Sequence:CCGGCAAAGACATGAAGACATGAAACTCGAGTTTCATGTCTTCATGTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-1666s1c1
Sequence:CCGGGCTATGAATGACCACACTGATCTCGAGATCAGTGTGGTCATTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-592s1c1
Sequence:CCGGCCTCCCAATTATCTCCTCTTTCTCGAGAAAGAGGAGATAATTGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-932s1c1
Sequence:CCGGCGTGAGTAACTCCATGCTCTTCTCGAGAAGAGCATGGAGTTACTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-854s1c1
Sequence:CCGGCCTCCATTGAAACACGCACATCTCGAGATGTGCGTGTTTCAATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001699.1-260s1c1
Sequence:CCGGCCTGTCTGGCTGATGATTCATCTCGAGATGAATCATCAGCCAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001699
LINC00885 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 885
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-801s1c1
Sequence:CCGGGCCTCCAAGATAAAGCACCAACTCGAGTTGGTGCTTTATCTTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001699.1-535s1c1
Sequence:CCGGCACGAACTACTTCATCCCTCTCTCGAGAGAGGGATGAAGTAGTTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-1362s1c1
Sequence:CCGGCAAAGACATGAAGACATGAAACTCGAGTTTCATGTCTTCATGTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204112    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-1666s1c1
Sequence:CCGGGCTATGAATGACCACACTGATCTCGAGATCAGTGTGGTCATTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-592s1c1
Sequence:CCGGCCTCCCAATTATCTCCTCTTTCTCGAGAAAGAGGAGATAATTGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-932s1c1
Sequence:CCGGCGTGAGTAACTCCATGCTCTTCTCGAGAAGAGCATGGAGTTACTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001699.1-854s1c1
Sequence:CCGGCCTCCATTGAAACACGCACATCTCGAGATGTGCGTGTTTCAATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001699.1-260s1c1
Sequence:CCGGCCTGTCTGGCTGATGATTCATCTCGAGATGAATCATCAGCCAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)