EMAIL THIS PAGE TO A FRIEND

LINC00898

long intergenic non-protein coding RNA 898

42 Gene Product Result for
Species: Human LINC00898(400932)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376021 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001693 Rosetta Predictions human pricing
XR_041671 Rosetta Predictions human pricing
XR_041672 Rosetta Predictions human pricing
XR_041673 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220672 predicted 3099
2 SASI_Hs01_00220673 predicted 2252
3 SASI_Hs01_00220674 predicted 2649
4 SASI_Hs01_00220675 predicted 2323
5 SASI_Hs01_00220676 predicted 2352
6 SASI_Hs01_00220677 predicted 3157
7 SASI_Hs01_00220678 predicted 2606
8 SASI_Hs01_00220679 predicted 2459
9 SASI_Hs01_00220680 predicted 2748
10 SASI_Hs01_00220681 predicted 3115
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529429 predicted 939
2 SASI_Hs02_00529430 predicted 911
3 SASI_Hs02_00529431 predicted 898
4 SASI_Hs02_00529432 predicted 588
5 SASI_Hs02_00529433 predicted 360
6 SASI_Hs02_00529434 predicted 518
7 SASI_Hs02_00529435 predicted 835
8 SASI_Hs02_00529436 predicted 958
9 SASI_Hs02_00529437 predicted 494
10 SASI_Hs02_00529438 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529439 predicted 945
2 SASI_Hs02_00529440 predicted 910
3 SASI_Hs02_00529441 predicted 896
4 SASI_Hs02_00529442 predicted 356
5 SASI_Hs02_00529443 predicted 577
6 SASI_Hs02_00529444 predicted 519
7 SASI_Hs02_00529445 predicted 844
8 SASI_Hs02_00529446 predicted 954
9 SASI_Hs02_00529447 predicted 498
10 SASI_Hs02_00529448 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529449 predicted 946
2 SASI_Hs02_00529450 predicted 910
3 SASI_Hs02_00529451 predicted 892
4 SASI_Hs02_00529452 predicted 359
5 SASI_Hs02_00529453 predicted 577
6 SASI_Hs02_00529454 predicted 521
7 SASI_Hs02_00529455 predicted 843
8 SASI_Hs02_00529456 predicted 958
9 SASI_Hs02_00529457 predicted 498
10 SASI_Hs02_00529458 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001693
LINC00898 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 898
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001693.1-3986s1c1
Sequence:CCGGGTTCACAAGATCCAGGGATTACTCGAGTAATCCCTGGATCTTGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2295s1c1
Sequence:CCGGGCAGAAGAGAGTCTTCAAGATCTCGAGATCTTGAAGACTCTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2464s1c1
Sequence:CCGGCAGTTGCTCTTCAGAACTCAACTCGAGTTGAGTTCTGAAGAGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2463s1c1
Sequence:CCGGCCAGTTGCTCTTCAGAACTCACTCGAGTGAGTTCTGAAGAGCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2411s1c1
Sequence:CCGGCCTTTGTCAACCCACAGAAGTCTCGAGACTTCTGTGGGTTGACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2577s1c1
Sequence:CCGGGAGAAATCACTGTGCCTCCAACTCGAGTTGGAGGCACAGTGATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2427s1c1
Sequence:CCGGGAAGTGACAAGTCCAAGTGCACTCGAGTGCACTTGGACTTGTCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2639s1c1
Sequence:CCGGGAGTCATTTCTCAGGATCTTACTCGAGTAAGATCCTGAGAAATGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2367s1c1
Sequence:CCGGCATTTCTCTACAGGTGCAATTCTCGAGAATTGCACCTGTAGAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001693
LINC00898 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 898
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001693.1-3986s1c1
Sequence:CCGGGTTCACAAGATCCAGGGATTACTCGAGTAATCCCTGGATCTTGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2295s1c1
Sequence:CCGGGCAGAAGAGAGTCTTCAAGATCTCGAGATCTTGAAGACTCTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2464s1c1
Sequence:CCGGCAGTTGCTCTTCAGAACTCAACTCGAGTTGAGTTCTGAAGAGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2463s1c1
Sequence:CCGGCCAGTTGCTCTTCAGAACTCACTCGAGTGAGTTCTGAAGAGCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2411s1c1
Sequence:CCGGCCTTTGTCAACCCACAGAAGTCTCGAGACTTCTGTGGGTTGACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2577s1c1
Sequence:CCGGGAGAAATCACTGTGCCTCCAACTCGAGTTGGAGGCACAGTGATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2427s1c1
Sequence:CCGGGAAGTGACAAGTCCAAGTGCACTCGAGTGCACTTGGACTTGTCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2639s1c1
Sequence:CCGGGAGTCATTTCTCAGGATCTTACTCGAGTAAGATCCTGAGAAATGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2367s1c1
Sequence:CCGGCATTTCTCTACAGGTGCAATTCTCGAGAATTGCACCTGTAGAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001693
LINC00898 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 898
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001693.1-3986s1c1
Sequence:CCGGGTTCACAAGATCCAGGGATTACTCGAGTAATCCCTGGATCTTGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2295s1c1
Sequence:CCGGGCAGAAGAGAGTCTTCAAGATCTCGAGATCTTGAAGACTCTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2464s1c1
Sequence:CCGGCAGTTGCTCTTCAGAACTCAACTCGAGTTGAGTTCTGAAGAGCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2463s1c1
Sequence:CCGGCCAGTTGCTCTTCAGAACTCACTCGAGTGAGTTCTGAAGAGCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2411s1c1
Sequence:CCGGCCTTTGTCAACCCACAGAAGTCTCGAGACTTCTGTGGGTTGACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2577s1c1
Sequence:CCGGGAGAAATCACTGTGCCTCCAACTCGAGTTGGAGGCACAGTGATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001693.1-2427s1c1
Sequence:CCGGGAAGTGACAAGTCCAAGTGCACTCGAGTGCACTTGGACTTGTCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2639s1c1
Sequence:CCGGGAGTCATTTCTCAGGATCTTACTCGAGTAAGATCCTGAGAAATGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001693.1-2367s1c1
Sequence:CCGGCATTTCTCTACAGGTGCAATTCTCGAGAATTGCACCTGTAGAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376021
LINC00898 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 898
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376021.1-3915s1c1
Sequence:CCGGCGGGTAATCTTCCCATCTCAACTCGAGTTGAGATGGGAAGATTACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376021
LINC00898 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 898
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376021.1-3915s1c1
Sequence:CCGGCGGGTAATCTTCCCATCTCAACTCGAGTTGAGATGGGAAGATTACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376021
LINC00898 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 898
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376021.1-3915s1c1
Sequence:CCGGCGGGTAATCTTCCCATCTCAACTCGAGTTGAGATGGGAAGATTACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)