EMAIL THIS PAGE TO A FRIEND

LINC00905

long intergenic non-protein coding RNA 905

102 Gene Product Result for
Species: Human LINC00905(148231)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152483 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034650 predicted 686
2 SASI_Hs01_00034651 predicted 749
3 SASI_Hs01_00034652 predicted 706
4 SASI_Hs01_00034653 predicted 674
5 SASI_Hs01_00034654 predicted 619
6 SASI_Hs01_00034655 predicted 684
7 SASI_Hs01_00034656 predicted 703
8 SASI_Hs01_00034657 predicted 573
9 SASI_Hs01_00034658 predicted 761
10 SASI_Hs01_00034659 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152483
LINC00905 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 905
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152483.1-1515s1c1
Sequence:CCGGGATTCACTGTTGGCTCCAGAACTCGAGTTCTGGAGCCAACAGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-449s1c1
Sequence:CCGGGTGCTGCATCTGTGATCTCAACTCGAGTTGAGATCACAGATGCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-451s1c1
Sequence:CCGGGCTGCATCTGTGATCTCAAGTCTCGAGACTTGAGATCACAGATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-436s1c1
Sequence:CCGGGTTGTGGTAAACAGTGCTGCACTCGAGTGCAGCACTGTTTACCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152483.1-1473s1c1
Sequence:CCGGGCTTGAAGGAAATGTCTACTTCTCGAGAAGTAGACATTTCCTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-793s1c1
Sequence:CCGGGAACTTCACTAGACACGCATCCTCGAGGATGCGTGTCTAGTGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-462s1c1
Sequence:CCGGGATCTCAAGTCTCTACTGGAACTCGAGTTCCAGTAGAGACTTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-336s1c1
Sequence:CCGGGAAATTATCCTTGAACCAGAACTCGAGTTCTGGTTCAAGGATAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152483
LINC00905 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 905
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152483.1-1515s1c1
Sequence:CCGGGATTCACTGTTGGCTCCAGAACTCGAGTTCTGGAGCCAACAGTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-449s1c1
Sequence:CCGGGTGCTGCATCTGTGATCTCAACTCGAGTTGAGATCACAGATGCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-451s1c1
Sequence:CCGGGCTGCATCTGTGATCTCAAGTCTCGAGACTTGAGATCACAGATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-436s1c1
Sequence:CCGGGTTGTGGTAAACAGTGCTGCACTCGAGTGCAGCACTGTTTACCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152483.1-1473s1c1
Sequence:CCGGGCTTGAAGGAAATGTCTACTTCTCGAGAAGTAGACATTTCCTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-793s1c1
Sequence:CCGGGAACTTCACTAGACACGCATCCTCGAGGATGCGTGTCTAGTGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-462s1c1
Sequence:CCGGGATCTCAAGTCTCTACTGGAACTCGAGTTCCAGTAGAGACTTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-336s1c1
Sequence:CCGGGAAATTATCCTTGAACCAGAACTCGAGTTCTGGTTCAAGGATAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152483
LINC00905 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 905
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152483.1-1515s1c1
Sequence:CCGGGATTCACTGTTGGCTCCAGAACTCGAGTTCTGGAGCCAACAGTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-449s1c1
Sequence:CCGGGTGCTGCATCTGTGATCTCAACTCGAGTTGAGATCACAGATGCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-451s1c1
Sequence:CCGGGCTGCATCTGTGATCTCAAGTCTCGAGACTTGAGATCACAGATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-436s1c1
Sequence:CCGGGTTGTGGTAAACAGTGCTGCACTCGAGTGCAGCACTGTTTACCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152483.1-1473s1c1
Sequence:CCGGGCTTGAAGGAAATGTCTACTTCTCGAGAAGTAGACATTTCCTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-793s1c1
Sequence:CCGGGAACTTCACTAGACACGCATCCTCGAGGATGCGTGTCTAGTGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-462s1c1
Sequence:CCGGGATCTCAAGTCTCTACTGGAACTCGAGTTCCAGTAGAGACTTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152483.1-336s1c1
Sequence:CCGGGAAATTATCCTTGAACCAGAACTCGAGTTCTGGTTCAAGGATAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)