EMAIL THIS PAGE TO A FRIEND

LINC00909

long intergenic non-protein coding RNA 909

42 Gene Product Result for
Species: Human LINC00909(400657)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008234 Rosetta Predictions human pricing
XR_039912 Rosetta Predictions human pricing
XR_039913 Rosetta Predictions human pricing
XR_039914 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061561 predicted 297
2 SASI_Hs01_00061562 predicted 576
3 SASI_Hs01_00061563 predicted 325
4 SASI_Hs01_00061564 predicted 538
5 SASI_Hs01_00061565 predicted 534
6 SASI_Hs01_00061566 predicted 520
7 SASI_Hs01_00061567 predicted 575
8 SASI_Hs01_00061568 predicted 309
9 SASI_Hs01_00061569 predicted 379
10 SASI_Hs01_00061570 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514183 predicted 229
2 SASI_Hs02_00514184 predicted 217
3 SASI_Hs02_00514185 predicted 308
4 SASI_Hs02_00514186 predicted 733
5 SASI_Hs02_00514187 predicted 396
6 SASI_Hs02_00514188 predicted 734
7 SASI_Hs02_00514189 predicted 687
8 SASI_Hs02_00514190 predicted 221
9 SASI_Hs02_00514191 predicted 319
10 SASI_Hs02_00514192 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514193 predicted 244
2 SASI_Hs02_00514194 predicted 305
3 SASI_Hs02_00514195 predicted 239
4 SASI_Hs02_00514196 predicted 208
5 SASI_Hs02_00514197 predicted 586
6 SASI_Hs02_00514198 predicted 213
7 SASI_Hs02_00514199 predicted 584
8 SASI_Hs02_00514200 predicted 242
9 SASI_Hs02_00514201 predicted 535
10 SASI_Hs02_00514202 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514203 predicted 238
2 SASI_Hs02_00514204 predicted 314
3 SASI_Hs02_00514205 predicted 240
4 SASI_Hs02_00514206 predicted 206
5 SASI_Hs02_00514207 predicted 588
6 SASI_Hs02_00514208 predicted 211
7 SASI_Hs02_00514209 predicted 587
8 SASI_Hs02_00514210 predicted 248
9 SASI_Hs02_00514211 predicted 534
10 SASI_Hs02_00514212 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008234
LINC00909 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 909
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-291s1c1
Sequence:CCGGGAGGGCTGTCTGGGATTTCTACTCGAGTAGAAATCCCAGACAGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-563s1c1
Sequence:CCGGGCAAGGCGAGAATGCTACTTTCTCGAGAAAGTAGCATTCTCGCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-535s1c1
Sequence:CCGGCCGATTTCGAGAAATGACTTTCTCGAGAAAGTCATTTCTCGAAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1068s1c1
Sequence:CCGGGACTCTGTAATGGGAAGTTATCTCGAGATAACTTCCCATTACAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1022s1c1
Sequence:CCGGCTTGCTAAAGAGGTTTGACTACTCGAGTAGTCAAACCTCTTTAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1922s1c1
Sequence:CCGGGCAGTGGCTAGGTTATGCTTACTCGAGTAAGCATAACCTAGCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008234
LINC00909 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 909
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-291s1c1
Sequence:CCGGGAGGGCTGTCTGGGATTTCTACTCGAGTAGAAATCCCAGACAGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-563s1c1
Sequence:CCGGGCAAGGCGAGAATGCTACTTTCTCGAGAAAGTAGCATTCTCGCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-535s1c1
Sequence:CCGGCCGATTTCGAGAAATGACTTTCTCGAGAAAGTCATTTCTCGAAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1068s1c1
Sequence:CCGGGACTCTGTAATGGGAAGTTATCTCGAGATAACTTCCCATTACAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1022s1c1
Sequence:CCGGCTTGCTAAAGAGGTTTGACTACTCGAGTAGTCAAACCTCTTTAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1922s1c1
Sequence:CCGGGCAGTGGCTAGGTTATGCTTACTCGAGTAAGCATAACCTAGCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008234
LINC00909 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 909
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-291s1c1
Sequence:CCGGGAGGGCTGTCTGGGATTTCTACTCGAGTAGAAATCCCAGACAGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-563s1c1
Sequence:CCGGGCAAGGCGAGAATGCTACTTTCTCGAGAAAGTAGCATTCTCGCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008234.1-535s1c1
Sequence:CCGGCCGATTTCGAGAAATGACTTTCTCGAGAAAGTCATTTCTCGAAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1068s1c1
Sequence:CCGGGACTCTGTAATGGGAAGTTATCTCGAGATAACTTCCCATTACAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1022s1c1
Sequence:CCGGCTTGCTAAAGAGGTTTGACTACTCGAGTAGTCAAACCTCTTTAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008234.1-1922s1c1
Sequence:CCGGGCAGTGGCTAGGTTATGCTTACTCGAGTAAGCATAACCTAGCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)