EMAIL THIS PAGE TO A FRIEND

LINC00922

long intergenic non-protein coding RNA 922

32 Gene Product Result for
Species: Human LINC00922(283867)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101346 Rosetta Predictions human pricing
XM_378606 Rosetta Predictions human pricing
XM_933064 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322675 predicted 961
2 SASI_Hs02_00322676 predicted 1161
3 SASI_Hs02_00322677 predicted 1183
4 SASI_Hs02_00322678 predicted 1037
5 SASI_Hs02_00322679 predicted 1299
6 SASI_Hs02_00322680 predicted 966
7 SASI_Hs02_00322681 predicted 992
8 SASI_Hs02_00322682 predicted 983
9 SASI_Hs02_00322683 predicted 1296
10 SASI_Hs02_00322684 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_378606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247946 predicted 1155
2 SASI_Hs01_00247947 predicted 1031
3 SASI_Hs01_00247948 predicted 1307
4 SASI_Hs01_00247949 predicted 959
5 SASI_Hs01_00247950 predicted 985
6 SASI_Hs01_00247951 predicted 985
7 SASI_Hs01_00247952 predicted 1289
8 SASI_Hs01_00247953 predicted 971
9 SASI_Hs01_00247954 predicted 963
10 SASI_Hs01_00247955 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290128 predicted 949
2 SASI_Hs01_00290129 predicted 973
3 SASI_Hs01_00290130 predicted 970
4 SASI_Hs01_00290131 predicted 953
5 SASI_Hs01_00290132 predicted 968
6 SASI_Hs01_00290133 predicted 960
7 SASI_Hs01_00290134 predicted 964
8 SASI_Hs01_00290135 predicted 951
9 SASI_Hs01_00290136 predicted 905
10 SASI_Hs01_00290137 predicted 943
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101346
LINC00922 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 922
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-686s21c1
Sequence:CCGGCCTGCACCTACAGATCTACACCTCGAGGTGTAGATCTGTAGGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-824s21c1
Sequence:CCGGCACAAGACCGCCAAGCATTAACTCGAGTTAATGCTTGGCGGTCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101346.1-1167s21c1
Sequence:CCGGTCGAAGGGTTCAATGTCATTCCTCGAGGAATGACATTGAACCCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-722s21c1
Sequence:CCGGTGCAGGAAGTGTTCATCTAAGCTCGAGCTTAGATGAACACTTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-655s21c1
Sequence:CCGGGAACCTACATTCACAACATAACTCGAGTTATGTTGTGAATGTAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101346
LINC00922 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 922
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-686s21c1
Sequence:CCGGCCTGCACCTACAGATCTACACCTCGAGGTGTAGATCTGTAGGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-824s21c1
Sequence:CCGGCACAAGACCGCCAAGCATTAACTCGAGTTAATGCTTGGCGGTCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101346.1-1167s21c1
Sequence:CCGGTCGAAGGGTTCAATGTCATTCCTCGAGGAATGACATTGAACCCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-722s21c1
Sequence:CCGGTGCAGGAAGTGTTCATCTAAGCTCGAGCTTAGATGAACACTTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-655s21c1
Sequence:CCGGGAACCTACATTCACAACATAACTCGAGTTATGTTGTGAATGTAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101346
LINC00922 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 922
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-686s21c1
Sequence:CCGGCCTGCACCTACAGATCTACACCTCGAGGTGTAGATCTGTAGGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-824s21c1
Sequence:CCGGCACAAGACCGCCAAGCATTAACTCGAGTTAATGCTTGGCGGTCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101346.1-1167s21c1
Sequence:CCGGTCGAAGGGTTCAATGTCATTCCTCGAGGAATGACATTGAACCCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-722s21c1
Sequence:CCGGTGCAGGAAGTGTTCATCTAAGCTCGAGCTTAGATGAACACTTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101346.1-655s21c1
Sequence:CCGGGAACCTACATTCACAACATAACTCGAGTTATGTTGTGAATGTAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)