EMAIL THIS PAGE TO A FRIEND

LINC00937

long intergenic non-protein coding RNA 937

41 Gene Product Result for
Species: Human LINC00937(389634)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012988 Rosetta Predictions human pricing
XR_041469 Rosetta Predictions human pricing
XR_041470 Rosetta Predictions human pricing
XR_041471 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159863 predicted 1423
2 SASI_Hs01_00159864 predicted 1337
3 SASI_Hs01_00159865 predicted 1431
4 SASI_Hs01_00159866 predicted 1152
5 SASI_Hs01_00159867 predicted 1168
6 SASI_Hs01_00159868 predicted 1216
7 SASI_Hs01_00159869 predicted 1213
8 SASI_Hs01_00159870 predicted 1117
9 SASI_Hs01_00159871 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527629 predicted 418
2 SASI_Hs02_00527630 predicted 426
3 SASI_Hs02_00527631 predicted 480
4 SASI_Hs02_00527632 predicted 587
5 SASI_Hs02_00527633 predicted 565
6 SASI_Hs02_00527634 predicted 529
7 SASI_Hs02_00527635 predicted 598
8 SASI_Hs02_00527636 predicted 466
9 SASI_Hs02_00527637 predicted 603
10 SASI_Hs02_00527638 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527639 predicted 425
2 SASI_Hs02_00527640 predicted 418
3 SASI_Hs02_00527641 predicted 479
4 SASI_Hs02_00527642 predicted 587
5 SASI_Hs02_00527643 predicted 567
6 SASI_Hs02_00527644 predicted 530
7 SASI_Hs02_00527645 predicted 599
8 SASI_Hs02_00527646 predicted 471
9 SASI_Hs02_00527647 predicted 602
10 SASI_Hs02_00527648 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527649 predicted 422
2 SASI_Hs02_00527650 predicted 423
3 SASI_Hs02_00527651 predicted 473
4 SASI_Hs02_00527652 predicted 592
5 SASI_Hs02_00527653 predicted 568
6 SASI_Hs02_00527654 predicted 525
7 SASI_Hs02_00527655 predicted 595
8 SASI_Hs02_00527656 predicted 463
9 SASI_Hs02_00527657 predicted 598
10 SASI_Hs02_00527658 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012988
LINC00937 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 937
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2432s1c1
Sequence:CCGGCCATGACAAAGACAGAGTCTTCTCGAGAAGACTCTGTCTTTGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2358s1c1
Sequence:CCGGCCCTGAAGTAAAGACATAATACTCGAGTATTATGTCTTTACTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1079s1c1
Sequence:CCGGGAGGAATCCTTCTTAGAAATTCTCGAGAATTTCTAAGAAGGATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1082s1c1
Sequence:CCGGGAATCCTTCTTAGAAATTCCTCTCGAGAGGAATTTCTAAGAAGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2178s1c1
Sequence:CCGGGCTGGATCATTATTCTGTCTTCTCGAGAAGACAGAATAATGATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1077s1c1
Sequence:CCGGCAGAGGAATCCTTCTTAGAAACTCGAGTTTCTAAGAAGGATTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1076s1c1
Sequence:CCGGGCAGAGGAATCCTTCTTAGAACTCGAGTTCTAAGAAGGATTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012988
LINC00937 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 937
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2432s1c1
Sequence:CCGGCCATGACAAAGACAGAGTCTTCTCGAGAAGACTCTGTCTTTGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2358s1c1
Sequence:CCGGCCCTGAAGTAAAGACATAATACTCGAGTATTATGTCTTTACTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1079s1c1
Sequence:CCGGGAGGAATCCTTCTTAGAAATTCTCGAGAATTTCTAAGAAGGATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1082s1c1
Sequence:CCGGGAATCCTTCTTAGAAATTCCTCTCGAGAGGAATTTCTAAGAAGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2178s1c1
Sequence:CCGGGCTGGATCATTATTCTGTCTTCTCGAGAAGACAGAATAATGATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1077s1c1
Sequence:CCGGCAGAGGAATCCTTCTTAGAAACTCGAGTTTCTAAGAAGGATTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1076s1c1
Sequence:CCGGGCAGAGGAATCCTTCTTAGAACTCGAGTTCTAAGAAGGATTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012988
LINC00937 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 937
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2432s1c1
Sequence:CCGGCCATGACAAAGACAGAGTCTTCTCGAGAAGACTCTGTCTTTGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2358s1c1
Sequence:CCGGCCCTGAAGTAAAGACATAATACTCGAGTATTATGTCTTTACTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1079s1c1
Sequence:CCGGGAGGAATCCTTCTTAGAAATTCTCGAGAATTTCTAAGAAGGATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1082s1c1
Sequence:CCGGGAATCCTTCTTAGAAATTCCTCTCGAGAGGAATTTCTAAGAAGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012988.1-2178s1c1
Sequence:CCGGGCTGGATCATTATTCTGTCTTCTCGAGAAGACAGAATAATGATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1077s1c1
Sequence:CCGGCAGAGGAATCCTTCTTAGAAACTCGAGTTTCTAAGAAGGATTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012988.1-1076s1c1
Sequence:CCGGGCAGAGGAATCCTTCTTAGAACTCGAGTTCTAAGAAGGATTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)