EMAIL THIS PAGE TO A FRIEND

LINC00951

long intergenic non-protein coding RNA 951

40 Gene Product Result for
Species: Human LINC00951(401260)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001705 Rosetta Predictions human pricing
XR_040731 Rosetta Predictions human pricing
XR_040732 Rosetta Predictions human pricing
XR_040733 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031269 predicted 2891
2 SASI_Hs01_00031270 predicted 2883
3 SASI_Hs01_00031271 predicted 2870
4 SASI_Hs01_00031272 predicted 2884
5 SASI_Hs01_00031273 predicted 2875
6 SASI_Hs01_00031274 predicted 2861
7 SASI_Hs01_00031275 predicted 2890
8 SASI_Hs01_00031276 predicted 2874
9 SASI_Hs01_00031277 predicted 2907
10 SASI_Hs01_00031278 predicted 2885
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521411 predicted 596
2 SASI_Hs02_00521412 predicted 101
3 SASI_Hs02_00521413 predicted 86
4 SASI_Hs02_00521414 predicted 741
5 SASI_Hs02_00521415 predicted 98
6 SASI_Hs02_00521416 predicted 443
7 SASI_Hs02_00521417 predicted 626
8 SASI_Hs02_00521418 predicted 472
9 SASI_Hs02_00521419 predicted 624
10 SASI_Hs02_00521420 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521421 predicted 594
2 SASI_Hs02_00521422 predicted 95
3 SASI_Hs02_00521423 predicted 84
4 SASI_Hs02_00521424 predicted 747
5 SASI_Hs02_00521425 predicted 101
6 SASI_Hs02_00521426 predicted 440
7 SASI_Hs02_00521427 predicted 625
8 SASI_Hs02_00521428 predicted 472
9 SASI_Hs02_00521429 predicted 624
10 SASI_Hs02_00521430 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521431 predicted 588
2 SASI_Hs02_00521432 predicted 101
3 SASI_Hs02_00521433 predicted 86
4 SASI_Hs02_00521434 predicted 741
5 SASI_Hs02_00521435 predicted 98
6 SASI_Hs02_00521436 predicted 441
7 SASI_Hs02_00521437 predicted 632
8 SASI_Hs02_00521438 predicted 476
9 SASI_Hs02_00521439 predicted 624
10 SASI_Hs02_00521440 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001705
LINC00951 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 951
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2386s1c1
Sequence:CCGGGTAACTAGAGCAACTGGTCTACTCGAGTAGACCAGTTGCTCTAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2878s1c1
Sequence:CCGGGAGGATTTGCAGCAACTGGTACTCGAGTACCAGTTGCTGCAAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2317s1c1
Sequence:CCGGCATCTGATTTCAGACCTGCCTCTCGAGAGGCAGGTCTGAAATCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2786s1c1
Sequence:CCGGGAAGAGGCATTTCCATGAGCTCTCGAGAGCTCATGGAAATGCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2881s1c1
Sequence:CCGGGATTTGCAGCAACTGGTATATCTCGAGATATACCAGTTGCTGCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001705
LINC00951 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 951
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2386s1c1
Sequence:CCGGGTAACTAGAGCAACTGGTCTACTCGAGTAGACCAGTTGCTCTAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2878s1c1
Sequence:CCGGGAGGATTTGCAGCAACTGGTACTCGAGTACCAGTTGCTGCAAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2317s1c1
Sequence:CCGGCATCTGATTTCAGACCTGCCTCTCGAGAGGCAGGTCTGAAATCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2786s1c1
Sequence:CCGGGAAGAGGCATTTCCATGAGCTCTCGAGAGCTCATGGAAATGCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2881s1c1
Sequence:CCGGGATTTGCAGCAACTGGTATATCTCGAGATATACCAGTTGCTGCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001705
LINC00951 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 951
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2386s1c1
Sequence:CCGGGTAACTAGAGCAACTGGTCTACTCGAGTAGACCAGTTGCTCTAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2878s1c1
Sequence:CCGGGAGGATTTGCAGCAACTGGTACTCGAGTACCAGTTGCTGCAAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2317s1c1
Sequence:CCGGCATCTGATTTCAGACCTGCCTCTCGAGAGGCAGGTCTGAAATCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2786s1c1
Sequence:CCGGGAAGAGGCATTTCCATGAGCTCTCGAGAGCTCATGGAAATGCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001705.1-2881s1c1
Sequence:CCGGGATTTGCAGCAACTGGTATATCTCGAGATATACCAGTTGCTGCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)