EMAIL THIS PAGE TO A FRIEND

LINC00969

long intergenic non-protein coding RNA 969

20 Gene Product Result for
Species: Human LINC00969(440993)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013714 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013714 Rosetta Predictions human pricing
XR_039810 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076802 predicted 2589
2 SASI_Hs01_00076803 predicted 2493
3 SASI_Hs01_00076804 predicted 2613
4 SASI_Hs01_00076805 predicted 1904
5 SASI_Hs01_00076806 predicted 2601
6 SASI_Hs01_00076807 predicted 2576
7 SASI_Hs01_00076808 predicted 2681
8 SASI_Hs01_00076809 predicted 2673
9 SASI_Hs01_00076810 predicted 2741
10 SASI_Hs01_00076811 predicted 2584
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513322 predicted 469
2 SASI_Hs02_00513323 predicted 469
3 SASI_Hs02_00513324 predicted 263
4 SASI_Hs02_00513325 predicted 25
5 SASI_Hs02_00513326 predicted 265
6 SASI_Hs02_00513327 predicted 241
7 SASI_Hs02_00513328 predicted 413
8 SASI_Hs02_00513329 predicted 234
9 SASI_Hs02_00513330 predicted 415
10 SASI_Hs02_00513331 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013714
LINC00969 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 969
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2061s1c1
Sequence:CCGGGAAGTTGCTACTGTGATGAATCTCGAGATTCATCACAGTAGCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013714.1-2465s1c1
Sequence:CCGGCTTGCAGTATGGATGTCTCTTCTCGAGAAGAGACATCCATACTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2279s1c1
Sequence:CCGGCATCTTGTCTATTTCAGGTCACTCGAGTGACCTGAAATAGACAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2270s1c1
Sequence:CCGGGAGATCTTGCATCTTGTCTATCTCGAGATAGACAAGATGCAAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-1922s1c1
Sequence:CCGGGCACTTCTATCTCTGCTTGATCTCGAGATCAAGCAGAGATAGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2155s1c1
Sequence:CCGGGATTCCACCTACAGCAAAGCTCTCGAGAGCTTTGCTGTAGGTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013714.1-2580s1c1
Sequence:CCGGGAGGACAGGAACATTTACCTTCTCGAGAAGGTAAATGTTCCTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013714
LINC00969 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 969
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2061s1c1
Sequence:CCGGGAAGTTGCTACTGTGATGAATCTCGAGATTCATCACAGTAGCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013714.1-2465s1c1
Sequence:CCGGCTTGCAGTATGGATGTCTCTTCTCGAGAAGAGACATCCATACTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2279s1c1
Sequence:CCGGCATCTTGTCTATTTCAGGTCACTCGAGTGACCTGAAATAGACAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2270s1c1
Sequence:CCGGGAGATCTTGCATCTTGTCTATCTCGAGATAGACAAGATGCAAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-1922s1c1
Sequence:CCGGGCACTTCTATCTCTGCTTGATCTCGAGATCAAGCAGAGATAGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2155s1c1
Sequence:CCGGGATTCCACCTACAGCAAAGCTCTCGAGAGCTTTGCTGTAGGTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013714.1-2580s1c1
Sequence:CCGGGAGGACAGGAACATTTACCTTCTCGAGAAGGTAAATGTTCCTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013714
LINC00969 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 969
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2061s1c1
Sequence:CCGGGAAGTTGCTACTGTGATGAATCTCGAGATTCATCACAGTAGCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013714.1-2465s1c1
Sequence:CCGGCTTGCAGTATGGATGTCTCTTCTCGAGAAGAGACATCCATACTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2279s1c1
Sequence:CCGGCATCTTGTCTATTTCAGGTCACTCGAGTGACCTGAAATAGACAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2270s1c1
Sequence:CCGGGAGATCTTGCATCTTGTCTATCTCGAGATAGACAAGATGCAAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-1922s1c1
Sequence:CCGGGCACTTCTATCTCTGCTTGATCTCGAGATCAAGCAGAGATAGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013714.1-2155s1c1
Sequence:CCGGGATTCCACCTACAGCAAAGCTCTCGAGAGCTTTGCTGTAGGTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013714.1-2580s1c1
Sequence:CCGGGAGGACAGGAACATTTACCTTCTCGAGAAGGTAAATGTTCCTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)