EMAIL THIS PAGE TO A FRIEND

LINC01002

long intergenic non-protein coding RNA 1002

9 Gene Product Result for
Species: Human LINC01002(399844)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004321 Rosetta Predictions human pricing
XR_040366 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060774 predicted 1040
2 SASI_Hs01_00060775 predicted 1537
3 SASI_Hs01_00060776 predicted 1028
4 SASI_Hs01_00060777 predicted 1028
5 SASI_Hs01_00060778 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518229 predicted 3590
2 SASI_Hs02_00518230 predicted 4750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374858
LINC01002 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 1002
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-2488s1c2
Sequence:CCGGCCACGATCAACGTGTTCTGTTCTCGAGAACAGAACACGTTGATCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-985s1c1
Sequence:CCGGCCAGCAAGTAAGCAAGCTCTTCTCGAGAAGAGCTTGCTTACTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-2275s1c1
Sequence:CCGGCTTGGCCTCTAATTTGTTTATCTCGAGATAAACAAATTAGAGGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-986s1c1
Sequence:CCGGCAGCAAGTAAGCAAGCTCTTTCTCGAGAAAGAGCTTGCTTACTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-1259s1c1
Sequence:CCGGCTGAAGAGCTTGGTTGCAGAACTCGAGTTCTGCAACCAAGCTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-723s1c1
Sequence:CCGGCTGCCTCTCAACAACCTCTTTCTCGAGAAAGAGGTTGTTGAGAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374858
LINC01002 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 1002
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-2488s1c2
Sequence:CCGGCCACGATCAACGTGTTCTGTTCTCGAGAACAGAACACGTTGATCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-985s1c1
Sequence:CCGGCCAGCAAGTAAGCAAGCTCTTCTCGAGAAGAGCTTGCTTACTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-2275s1c1
Sequence:CCGGCTTGGCCTCTAATTTGTTTATCTCGAGATAAACAAATTAGAGGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-986s1c1
Sequence:CCGGCAGCAAGTAAGCAAGCTCTTTCTCGAGAAAGAGCTTGCTTACTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-1259s1c1
Sequence:CCGGCTGAAGAGCTTGGTTGCAGAACTCGAGTTCTGCAACCAAGCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-723s1c1
Sequence:CCGGCTGCCTCTCAACAACCTCTTTCTCGAGAAAGAGGTTGTTGAGAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374858
LINC01002 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 1002
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-2488s1c2
Sequence:CCGGCCACGATCAACGTGTTCTGTTCTCGAGAACAGAACACGTTGATCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-985s1c1
Sequence:CCGGCCAGCAAGTAAGCAAGCTCTTCTCGAGAAGAGCTTGCTTACTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-2275s1c1
Sequence:CCGGCTTGGCCTCTAATTTGTTTATCTCGAGATAAACAAATTAGAGGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-986s1c1
Sequence:CCGGCAGCAAGTAAGCAAGCTCTTTCTCGAGAAAGAGCTTGCTTACTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-1259s1c1
Sequence:CCGGCTGAAGAGCTTGGTTGCAGAACTCGAGTTCTGCAACCAAGCTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374858.1-723s1c1
Sequence:CCGGCTGCCTCTCAACAACCTCTTTCTCGAGAAAGAGGTTGTTGAGAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)