EMAIL THIS PAGE TO A FRIEND

LINGO1

leucine rich repeat and Ig domain containing 1

140 Gene Product Result for
Synonyms: LERN1 LRRN6A UNQ201
Gene ID:
Mouse(235402) leucine rich repeat and Ig domain containing 1
Rat(315691) leucine rich repeat and Ig domain containing 1
domestic guinea pig(100733754) leucine rich repeat and Ig domain containing 1
naked mole-rat(101721017) leucine rich repeat and Ig domain containing 1
sheep(101117451) leucine rich repeat and Ig domain containing 1
chicken(415344) leucine rich repeat and Ig domain containing 1
dog(487660) leucine rich repeat and Ig domain containing 1
domestic cat(101096814) leucine rich repeat and Ig domain containing 1
Horse(100061441) leucine rich repeat and Ig domain containing 1
cow(520694) leucine rich repeat and Ig domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301603 ANTI-LINGO-1(LRRN6A)-S596 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB4301849 Anti-LINGO1 affinity isolated antibody human, mouse
immunohistochemistry pricing
SAB1305039 ANTI-LINGO1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1303383 ANTI-LINGO1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1304325 ANTI-LINGO1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA011630 Anti-LINGO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2700579 Anti-LINGO1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2900691 Anti-LINGO1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA074653 Anti-LINGO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB1302798 ANTI-PHOSPHO-LINGO-1(LRRN6A)-PS596 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032808 Rosetta Predictions human pricing
XM_001068291 Rosetta Predictions rat pricing
XM_001070567 Rosetta Predictions rat pricing
XM_001070615 Rosetta Predictions rat pricing
XM_236268 Rosetta Predictions rat pricing
NM_181074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148935 predicted 1199
2 SASI_Hs01_00148936 predicted 849
3 SASI_Hs02_00360376 predicted 1108
4 SASI_Hs01_00148937 predicted 577
5 SASI_Hs01_00148938 predicted 1139
6 SASI_Hs01_00148939 predicted 498
7 SASI_Hs01_00148940 predicted 1284
8 SASI_Hs02_00360377 predicted 503
9 SASI_Hs01_00148941 predicted 821
10 SASI_Hs01_00148942 predicted 516
11 SASI_Hs01_00148943 predicted 604
12 SASI_Hs01_00148944 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324111 predicted 363
2 SASI_Rn02_00324112 predicted 1052
3 SASI_Rn02_00324113 predicted 658
4 SASI_Rn02_00324114 predicted 1257
5 SASI_Rn02_00324115 predicted 753
6 SASI_Rn02_00324116 predicted 733
7 SASI_Rn02_00324117 predicted 517
8 SASI_Rn02_00324118 predicted 787
9 SASI_Rn02_00324119 predicted 1347
10 SASI_Rn02_00324120 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332089 predicted 360
2 SASI_Rn02_00332090 predicted 1047
3 SASI_Rn02_00332091 predicted 660
4 SASI_Rn02_00332092 predicted 1263
5 SASI_Rn02_00332093 predicted 749
6 SASI_Rn02_00332094 predicted 727
7 SASI_Rn02_00332095 predicted 513
8 SASI_Rn02_00332096 predicted 782
9 SASI_Rn02_00332097 predicted 1351
10 SASI_Rn02_00332098 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332235 predicted 1077
2 SASI_Rn02_00332236 predicted 1770
3 SASI_Rn02_00332237 predicted 1371
4 SASI_Rn02_00332238 predicted 1974
5 SASI_Rn02_00332239 predicted 1465
6 SASI_Rn02_00332240 predicted 1447
7 SASI_Rn02_00332241 predicted 1234
8 SASI_Rn02_00332242 predicted 1499
9 SASI_Rn02_00332243 predicted 2066
10 SASI_Rn02_00332244 predicted 1960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389924 predicted 831
2 SASI_Rn02_00389925 predicted 1527
3 SASI_Rn02_00389926 predicted 1126
4 SASI_Rn02_00389927 predicted 1728
5 SASI_Rn02_00389928 predicted 1219
6 SASI_Rn02_00389929 predicted 1201
7 SASI_Rn02_00389930 predicted 984
8 SASI_Rn02_00389931 predicted 1251
9 SASI_Rn02_00389932 predicted 1822
10 SASI_Rn02_00389933 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137609 predicted 2015
2 SASI_Mm01_00137610 predicted 1526
3 SASI_Mm01_00137611 predicted 1435
4 SASI_Mm02_00349639 predicted 1829
5 SASI_Mm01_00137612 predicted 1156
6 SASI_Mm01_00137613 predicted 820
7 SASI_Mm01_00137614 predicted 1847
8 SASI_Mm01_00137615 predicted 1128
9 SASI_Mm01_00137616 predicted 1449
10 SASI_Mm01_00137617 predicted 1660
11 SASI_Mm01_00137618 predicted 1806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032808
VALIDATED
LINGO1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2341s21c1
Sequence:CCGGGCCCTCTTCCAACTCAGTTTCCTCGAGGAAACTGAGTTGGAAGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-1142s1c1
Sequence:CCGGCCGACTAAAGGTCTTGGAGATCTCGAGATCTCCAAGACCTTTAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-1022s1c1
Sequence:CCGGGAAATGCAACCTGACCTCCATCTCGAGATGGAGGTCAGGTTGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-2180s1c1
Sequence:CCGGCAAGGGCAACACAAAGCACAACTCGAGTTGTGCTTTGTGTTGCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-950s1c1
Sequence:CCGGCGACAATGACCTCGTCTACATCTCGAGATGTAGACGAGGTCATTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-890s1c1
Sequence:CCGGCGTTATCCTACTGGACTACATCTCGAGATGTAGTCCAGTAGGATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-2261s1c1
Sequence:CCGGCCGCAAGTTCAACATGAAGATCTCGAGATCTTCATGTTGAACTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-875s1c1
Sequence:CCGGCAGCGAGAACAAGATCGTTATCTCGAGATAACGATCTTGTTCTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2175s21c1
Sequence:CCGGACACGCGGCAGAGTCAATAATCTCGAGATTATTGACTCTGCCGCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032808.5-1824s21c1
Sequence:CCGGACAACATCGAGATCGAGTATGCTCGAGCATACTCGATCTCGATGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-2009s1c1
Sequence:CCGGCTTCGCTTTCATCTCCAACCACTCGAGTGGTTGGAGATGAAAGCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2222s21c1
Sequence:CCGGTGTAACTTGGGTTTCAATAATCTCGAGATTATTGAAACCCAAGTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032808
VALIDATED
LINGO1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2341s21c1
Sequence:CCGGGCCCTCTTCCAACTCAGTTTCCTCGAGGAAACTGAGTTGGAAGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-1142s1c1
Sequence:CCGGCCGACTAAAGGTCTTGGAGATCTCGAGATCTCCAAGACCTTTAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-1022s1c1
Sequence:CCGGGAAATGCAACCTGACCTCCATCTCGAGATGGAGGTCAGGTTGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-2180s1c1
Sequence:CCGGCAAGGGCAACACAAAGCACAACTCGAGTTGTGCTTTGTGTTGCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-950s1c1
Sequence:CCGGCGACAATGACCTCGTCTACATCTCGAGATGTAGACGAGGTCATTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-890s1c1
Sequence:CCGGCGTTATCCTACTGGACTACATCTCGAGATGTAGTCCAGTAGGATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-2261s1c1
Sequence:CCGGCCGCAAGTTCAACATGAAGATCTCGAGATCTTCATGTTGAACTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-875s1c1
Sequence:CCGGCAGCGAGAACAAGATCGTTATCTCGAGATAACGATCTTGTTCTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2175s21c1
Sequence:CCGGACACGCGGCAGAGTCAATAATCTCGAGATTATTGACTCTGCCGCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032808.5-1824s21c1
Sequence:CCGGACAACATCGAGATCGAGTATGCTCGAGCATACTCGATCTCGATGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-2009s1c1
Sequence:CCGGCTTCGCTTTCATCTCCAACCACTCGAGTGGTTGGAGATGAAAGCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2222s21c1
Sequence:CCGGTGTAACTTGGGTTTCAATAATCTCGAGATTATTGAAACCCAAGTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032808
VALIDATED
LINGO1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2341s21c1
Sequence:CCGGGCCCTCTTCCAACTCAGTTTCCTCGAGGAAACTGAGTTGGAAGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-1142s1c1
Sequence:CCGGCCGACTAAAGGTCTTGGAGATCTCGAGATCTCCAAGACCTTTAGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-1022s1c1
Sequence:CCGGGAAATGCAACCTGACCTCCATCTCGAGATGGAGGTCAGGTTGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-2180s1c1
Sequence:CCGGCAAGGGCAACACAAAGCACAACTCGAGTTGTGCTTTGTGTTGCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-950s1c1
Sequence:CCGGCGACAATGACCTCGTCTACATCTCGAGATGTAGACGAGGTCATTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-890s1c1
Sequence:CCGGCGTTATCCTACTGGACTACATCTCGAGATGTAGTCCAGTAGGATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032808.3-2261s1c1
Sequence:CCGGCCGCAAGTTCAACATGAAGATCTCGAGATCTTCATGTTGAACTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-875s1c1
Sequence:CCGGCAGCGAGAACAAGATCGTTATCTCGAGATAACGATCTTGTTCTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2175s21c1
Sequence:CCGGACACGCGGCAGAGTCAATAATCTCGAGATTATTGACTCTGCCGCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032808.5-1824s21c1
Sequence:CCGGACAACATCGAGATCGAGTATGCTCGAGCATACTCGATCTCGATGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032808.3-2009s1c1
Sequence:CCGGCTTCGCTTTCATCTCCAACCACTCGAGTGGTTGGAGATGAAAGCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032808.5-2222s21c1
Sequence:CCGGTGTAACTTGGGTTTCAATAATCTCGAGATTATTGAAACCCAAGTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181074
VALIDATED
LINGO1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181074.4-2590s21c1
Sequence:CCGGCTCTGTAACTTGGGTTTCAATCTCGAGATTGAAACCCAAGTTACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-2590s1c1
Sequence:CCGGCTCTGTAACTTGGGTTTCAATCTCGAGATTGAAACCCAAGTTACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-898s1c1
Sequence:CCGGCAGTGAGAACAAGATCGTCATCTCGAGATGACGATCTTGTTCTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-1237s1c1
Sequence:CCGGCAACCTGACATCCCTATCCATCTCGAGATGGATAGGGATGTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-1237s21c1
Sequence:CCGGCAACCTGACATCCCTATCCATCTCGAGATGGATAGGGATGTCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-898s21c1
Sequence:CCGGCAGTGAGAACAAGATCGTCATCTCGAGATGACGATCTTGTTCTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181074.4-2547s21c1
Sequence:CCGGCGGCAGAGTCAATAATTCAATCTCGAGATTGAATTATTGACTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181074.4-1111s1c1
Sequence:CCGGGCTACGACATCTCAACATCAACTCGAGTTGATGTTGAGATGTCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-2547s1c1
Sequence:CCGGCGGCAGAGTCAATAATTCAATCTCGAGATTGAATTATTGACTCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-1111s21c1
Sequence:CCGGGCTACGACATCTCAACATCAACTCGAGTTGATGTTGAGATGTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181074
VALIDATED
LINGO1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181074.4-2590s21c1
Sequence:CCGGCTCTGTAACTTGGGTTTCAATCTCGAGATTGAAACCCAAGTTACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-2590s1c1
Sequence:CCGGCTCTGTAACTTGGGTTTCAATCTCGAGATTGAAACCCAAGTTACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-898s1c1
Sequence:CCGGCAGTGAGAACAAGATCGTCATCTCGAGATGACGATCTTGTTCTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-1237s1c1
Sequence:CCGGCAACCTGACATCCCTATCCATCTCGAGATGGATAGGGATGTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-1237s21c1
Sequence:CCGGCAACCTGACATCCCTATCCATCTCGAGATGGATAGGGATGTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-898s21c1
Sequence:CCGGCAGTGAGAACAAGATCGTCATCTCGAGATGACGATCTTGTTCTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181074.4-2547s21c1
Sequence:CCGGCGGCAGAGTCAATAATTCAATCTCGAGATTGAATTATTGACTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181074.4-1111s1c1
Sequence:CCGGGCTACGACATCTCAACATCAACTCGAGTTGATGTTGAGATGTCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-2547s1c1
Sequence:CCGGCGGCAGAGTCAATAATTCAATCTCGAGATTGAATTATTGACTCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-1111s21c1
Sequence:CCGGGCTACGACATCTCAACATCAACTCGAGTTGATGTTGAGATGTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181074
VALIDATED
LINGO1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181074.4-2590s21c1
Sequence:CCGGCTCTGTAACTTGGGTTTCAATCTCGAGATTGAAACCCAAGTTACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-2590s1c1
Sequence:CCGGCTCTGTAACTTGGGTTTCAATCTCGAGATTGAAACCCAAGTTACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-898s1c1
Sequence:CCGGCAGTGAGAACAAGATCGTCATCTCGAGATGACGATCTTGTTCTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-1237s1c1
Sequence:CCGGCAACCTGACATCCCTATCCATCTCGAGATGGATAGGGATGTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-1237s21c1
Sequence:CCGGCAACCTGACATCCCTATCCATCTCGAGATGGATAGGGATGTCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-898s21c1
Sequence:CCGGCAGTGAGAACAAGATCGTCATCTCGAGATGACGATCTTGTTCTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181074.4-2547s21c1
Sequence:CCGGCGGCAGAGTCAATAATTCAATCTCGAGATTGAATTATTGACTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181074.4-1111s1c1
Sequence:CCGGGCTACGACATCTCAACATCAACTCGAGTTGATGTTGAGATGTCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181074.4-2547s1c1
Sequence:CCGGCGGCAGAGTCAATAATTCAATCTCGAGATTGAATTATTGACTCTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181074.4-1111s21c1
Sequence:CCGGGCTACGACATCTCAACATCAACTCGAGTTGATGTTGAGATGTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)