EMAIL THIS PAGE TO A FRIEND

LINGO2

leucine rich repeat and Ig domain containing 2

74 Gene Product Result for
Synonyms: LERN3 LRRN6C
UniProtKB ID: Q7L985, A8K4K7, B2RPM5, Q6ZMD0
Gene ID:
Mouse(242384) leucine rich repeat and Ig domain containing 2
Rat(313156) leucine rich repeat and Ig domain containing 2
Zebrafish(564052) leucine rich repeat and Ig domain containing 2
dog(481570) leucine rich repeat and Ig domain containing 2
cow(539968) leucine rich repeat and Ig domain containing 2
Horse(100053549) leucine rich repeat and Ig domain containing 2
domestic cat(101092801) leucine rich repeat and Ig domain containing 2
chicken(431646) leucine rich repeat and Ig domain containing 2
sheep(101112027) leucine rich repeat and Ig domain containing 2
Domestic Rabbit(100348197) leucine rich repeat and Ig domain containing 2
domestic guinea pig(100717608) leucine rich repeat and Ig domain containing 2
naked mole-rat(101713176) leucine rich repeat and Ig domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152570 Rosetta Predictions human pricing
NM_001107926 Rosetta Predictions rat pricing
XR_006940 Rosetta Predictions rat pricing
NM_175516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154352 predicted 1038
2 SASI_Hs01_00154353 predicted 1886
3 SASI_Hs01_00154354 predicted 699
4 SASI_Hs01_00154356 predicted 899
5 SASI_Hs01_00154357 predicted 944
6 SASI_Hs01_00154358 predicted 995
7 SASI_Hs02_00366384 predicted 882
8 SASI_Hs01_00154359 predicted 1443
9 SASI_Hs01_00154360 predicted 2297
10 SASI_Hs02_00366385 predicted 1368
11 SASI_Hs01_00154351 predicted 1338
12 SASI_Hs01_00154355 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233645 predicted 1080
2 SASI_Rn02_00233646 predicted 584
3 SASI_Rn02_00233647 predicted 2186
4 SASI_Rn02_00233648 predicted 1140
5 SASI_Rn02_00233649 predicted 775
6 SASI_Rn02_00233650 predicted 2170
7 SASI_Rn02_00233651 predicted 2237
8 SASI_Rn02_00233652 predicted 635
9 SASI_Rn02_00233653 predicted 1045
10 SASI_Rn02_00233654 predicted 1983
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158008 predicted 3647
2 SASI_Rn01_00158009 predicted 3601
3 SASI_Rn01_00158010 predicted 3622
4 SASI_Rn01_00158011 predicted 3712
5 SASI_Rn01_00158012 predicted 3626
6 SASI_Rn01_00158013 predicted 3512
7 SASI_Rn01_00158014 predicted 3636
8 SASI_Rn01_00158015 predicted 3684
9 SASI_Rn01_00158016 predicted 3854
10 SASI_Rn01_00158017 predicted 3831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120807 predicted 691
2 SASI_Mm01_00120808 predicted 2194
3 SASI_Mm01_00120809 predicted 552
4 SASI_Mm01_00120810 predicted 387
5 SASI_Mm01_00120811 predicted 770
6 SASI_Mm01_00120812 predicted 2181
7 SASI_Mm01_00120813 predicted 628
8 SASI_Mm01_00120814 predicted 1079
9 SASI_Mm01_00120815 predicted 2159
10 SASI_Mm01_00120816 predicted 1834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152570
LINGO2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-2442s1c1
Sequence:CCGGCCCAGGAGGTTCAACATGAAACTCGAGTTTCATGTTGAACCTCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1268s1c1
Sequence:CCGGGCATCTGAAGCATCTCAATATCTCGAGATATTGAGATGCTTCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152570.1-2486s1c1
Sequence:CCGGCATTACTGTCTCTTTGTCAATCTCGAGATTGACAAAGAGACAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1409s1c1
Sequence:CCGGCCTTTCAGTCACCAACACCAACTCGAGTTGGTGTTGGTGACTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1210s1c1
Sequence:CCGGGCAACTTAACAGCAGTACCAACTCGAGTTGGTACTGCTGTTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152570.1-2074s21c1
Sequence:CCGGATCAAGACAGCGGGATGTATGCTCGAGCATACATCCCGCTGTCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152570.1-946s21c1
Sequence:CCGGGAGCATTCAACAATCTCTTTACTCGAGTAAAGAGATTGTTGAATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152570
LINGO2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-2442s1c1
Sequence:CCGGCCCAGGAGGTTCAACATGAAACTCGAGTTTCATGTTGAACCTCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1268s1c1
Sequence:CCGGGCATCTGAAGCATCTCAATATCTCGAGATATTGAGATGCTTCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152570.1-2486s1c1
Sequence:CCGGCATTACTGTCTCTTTGTCAATCTCGAGATTGACAAAGAGACAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1409s1c1
Sequence:CCGGCCTTTCAGTCACCAACACCAACTCGAGTTGGTGTTGGTGACTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1210s1c1
Sequence:CCGGGCAACTTAACAGCAGTACCAACTCGAGTTGGTACTGCTGTTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152570.1-2074s21c1
Sequence:CCGGATCAAGACAGCGGGATGTATGCTCGAGCATACATCCCGCTGTCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152570.1-946s21c1
Sequence:CCGGGAGCATTCAACAATCTCTTTACTCGAGTAAAGAGATTGTTGAATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152570
LINGO2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-2442s1c1
Sequence:CCGGCCCAGGAGGTTCAACATGAAACTCGAGTTTCATGTTGAACCTCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1268s1c1
Sequence:CCGGGCATCTGAAGCATCTCAATATCTCGAGATATTGAGATGCTTCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152570.1-2486s1c1
Sequence:CCGGCATTACTGTCTCTTTGTCAATCTCGAGATTGACAAAGAGACAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1409s1c1
Sequence:CCGGCCTTTCAGTCACCAACACCAACTCGAGTTGGTGTTGGTGACTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152570.1-1210s1c1
Sequence:CCGGGCAACTTAACAGCAGTACCAACTCGAGTTGGTACTGCTGTTAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152570.1-2074s21c1
Sequence:CCGGATCAAGACAGCGGGATGTATGCTCGAGCATACATCCCGCTGTCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152570.1-946s21c1
Sequence:CCGGGAGCATTCAACAATCTCTTTACTCGAGTAAAGAGATTGTTGAATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175516
LINGO2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000188817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-684s1c1
Sequence:CCGGCGCCTTAAGTTGGTCCCTTTACTCGAGTAAAGGGACCAACTTAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-1499s1c1
Sequence:CCGGCATCCGTGAGAGATCATTTAACTCGAGTTAAATGATCTCTCACGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-1919s1c1
Sequence:CCGGCGGCACTAATGCCAATACTTTCTCGAGAAAGTATTGGCATTAGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175516.2-2210s1c1
Sequence:CCGGCGTCTGATAGAGTGACTCGATCTCGAGATCGAGTCACTCTATCAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175516
LINGO2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000188817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-684s1c1
Sequence:CCGGCGCCTTAAGTTGGTCCCTTTACTCGAGTAAAGGGACCAACTTAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-1499s1c1
Sequence:CCGGCATCCGTGAGAGATCATTTAACTCGAGTTAAATGATCTCTCACGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-1919s1c1
Sequence:CCGGCGGCACTAATGCCAATACTTTCTCGAGAAAGTATTGGCATTAGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175516.2-2210s1c1
Sequence:CCGGCGTCTGATAGAGTGACTCGATCTCGAGATCGAGTCACTCTATCAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175516
LINGO2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000188817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-684s1c1
Sequence:CCGGCGCCTTAAGTTGGTCCCTTTACTCGAGTAAAGGGACCAACTTAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-1499s1c1
Sequence:CCGGCATCCGTGAGAGATCATTTAACTCGAGTTAAATGATCTCTCACGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175516.2-1919s1c1
Sequence:CCGGCGGCACTAATGCCAATACTTTCTCGAGAAAGTATTGGCATTAGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175516.2-2210s1c1
Sequence:CCGGCGTCTGATAGAGTGACTCGATCTCGAGATCGAGTCACTCTATCAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)