EMAIL THIS PAGE TO A FRIEND

LINGO3

leucine rich repeat and Ig domain containing 3

55 Gene Product Result for
Synonyms: LERN2 LRRN6B
UniProtKB ID: P0C6S8
Gene ID:
Mouse(237403) leucine rich repeat and Ig domain containing 3
Rat(690755) leucine rich repeat and Ig domain containing 3
domestic guinea pig(100719075) leucine rich repeat and Ig domain containing 3
naked mole-rat(101709477) leucine rich repeat and Ig domain containing 3
sheep(101120748) leucine rich repeat and Ig domain containing 3
Zebrafish(100151059) leucine rich repeat and Ig domain containing 3
cow(618425) leucine rich repeat and Ig domain containing 3
dog(612172) leucine rich repeat and Ig domain containing 3
chicken(420075) leucine rich repeat and Ig domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU201161 MISSION® esiRNA esiRNA targeting mouse Lingo3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101391 Rosetta Predictions human pricing
XM_928228 Rosetta Predictions human pricing
NM_001109609 Rosetta Predictions rat pricing
NM_001013758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322772 predicted 939
2 SASI_Hs02_00322773 predicted 855
3 SASI_Hs02_00322774 predicted 533
4 SASI_Hs02_00322775 predicted 1216
5 SASI_Hs02_00322776 predicted 592
6 SASI_Hs02_00322777 predicted 522
7 SASI_Hs02_00322778 predicted 1313
8 SASI_Hs02_00322779 predicted 1131
9 SASI_Hs02_00322780 predicted 1388
10 SASI_Hs02_00322781 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270051 predicted 818
2 SASI_Hs01_00270052 predicted 735
3 SASI_Hs01_00270053 predicted 956
4 SASI_Hs01_00270054 predicted 417
5 SASI_Hs01_00270055 predicted 962
6 SASI_Hs01_00270056 predicted 1094
7 SASI_Hs01_00270057 predicted 470
8 SASI_Hs01_00270058 predicted 405
9 SASI_Hs01_00270059 predicted 544
10 SASI_Hs01_00270060 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250057 predicted 788
2 SASI_Rn02_00250058 predicted 1404
3 SASI_Rn02_00250059 predicted 1325
4 SASI_Rn02_00250060 predicted 1084
5 SASI_Rn02_00250061 predicted 477
6 SASI_Rn02_00250062 predicted 952
7 SASI_Rn02_00250063 predicted 868
8 SASI_Rn02_00250064 predicted 384
9 SASI_Rn02_00250065 predicted 684
10 SASI_Rn02_00250066 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081420 predicted 1311
2 SASI_Mm01_00081421 predicted 2312
3 SASI_Mm01_00081422 predicted 861
4 SASI_Mm01_00081423 predicted 2013
5 SASI_Mm01_00081424 predicted 1096
6 SASI_Mm01_00081425 predicted 1123
7 SASI_Mm01_00081426 predicted 476
8 SASI_Mm01_00081427 predicted 952
9 SASI_Mm01_00081428 predicted 1942
10 SASI_Mm01_00081429 predicted 2007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101391
LINGO3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-600s21c1
Sequence:CCGGGGCGACAACGACCTGGTATTCCTCGAGGAATACCAGGTCGTTGTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101391.1-1958s21c1
Sequence:CCGGCGCGTGTCCACCTATGCATTTCTCGAGAAATGCATAGGTGGACACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-546s21c1
Sequence:CCGGATCCTGCTGGACTACACTTTCCTCGAGGAAAGTGTAGTCCAGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-800s21c1
Sequence:CCGGGCTGCACCTGGAGATTGACAACTCGAGTTGTCAATCTCCAGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101391
LINGO3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-600s21c1
Sequence:CCGGGGCGACAACGACCTGGTATTCCTCGAGGAATACCAGGTCGTTGTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101391.1-1958s21c1
Sequence:CCGGCGCGTGTCCACCTATGCATTTCTCGAGAAATGCATAGGTGGACACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-546s21c1
Sequence:CCGGATCCTGCTGGACTACACTTTCCTCGAGGAAAGTGTAGTCCAGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-800s21c1
Sequence:CCGGGCTGCACCTGGAGATTGACAACTCGAGTTGTCAATCTCCAGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101391
LINGO3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-600s21c1
Sequence:CCGGGGCGACAACGACCTGGTATTCCTCGAGGAATACCAGGTCGTTGTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101391.1-1958s21c1
Sequence:CCGGCGCGTGTCCACCTATGCATTTCTCGAGAAATGCATAGGTGGACACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-546s21c1
Sequence:CCGGATCCTGCTGGACTACACTTTCCTCGAGGAAAGTGTAGTCCAGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101391.1-800s21c1
Sequence:CCGGGCTGCACCTGGAGATTGACAACTCGAGTTGTCAATCTCCAGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013758
LINGO3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013758.1-3267s21c1
Sequence:CCGGAGTGCCTTTAGAGTTATTAAACTCGAGTTTAATAACTCTAAAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-378s21c1
Sequence:CCGGAGCTGGACCTCAACCATAATGCTCGAGCATTATGGTTGAGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-544s21c1
Sequence:CCGGGCTGGTCATCCTGCTGGATTTCTCGAGAAATCCAGCAGGATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-1792s21c1
Sequence:CCGGCCGCGGACAGCACAAGAATAACTCGAGTTATTCTTGTGCTGTCCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-1820s21c1
Sequence:CCGGGTGGAATATTCCTTCCGTAAGCTCGAGCTTACGGAAGGAATATTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013758
LINGO3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013758.1-3267s21c1
Sequence:CCGGAGTGCCTTTAGAGTTATTAAACTCGAGTTTAATAACTCTAAAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-378s21c1
Sequence:CCGGAGCTGGACCTCAACCATAATGCTCGAGCATTATGGTTGAGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-544s21c1
Sequence:CCGGGCTGGTCATCCTGCTGGATTTCTCGAGAAATCCAGCAGGATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-1792s21c1
Sequence:CCGGCCGCGGACAGCACAAGAATAACTCGAGTTATTCTTGTGCTGTCCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-1820s21c1
Sequence:CCGGGTGGAATATTCCTTCCGTAAGCTCGAGCTTACGGAAGGAATATTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013758
LINGO3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013758.1-3267s21c1
Sequence:CCGGAGTGCCTTTAGAGTTATTAAACTCGAGTTTAATAACTCTAAAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-378s21c1
Sequence:CCGGAGCTGGACCTCAACCATAATGCTCGAGCATTATGGTTGAGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-544s21c1
Sequence:CCGGGCTGGTCATCCTGCTGGATTTCTCGAGAAATCCAGCAGGATGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-1792s21c1
Sequence:CCGGCCGCGGACAGCACAAGAATAACTCGAGTTATTCTTGTGCTGTCCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013758.1-1820s21c1
Sequence:CCGGGTGGAATATTCCTTCCGTAAGCTCGAGCTTACGGAAGGAATATTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)