EMAIL THIS PAGE TO A FRIEND

LINGO4

leucine rich repeat and Ig domain containing 4

57 Gene Product Result for
Synonyms: DAAT9248 LRRN6D PRO34002
UniProtKB ID: Q6UY18
Gene ID:
Mouse(320747) leucine rich repeat and Ig domain containing 4
Rat(499668) leucine rich repeat and Ig domain containing 4
dog(483204) leucine rich repeat and Ig domain containing 4
domestic cat(101081655) leucine rich repeat and Ig domain containing 4
cow(613529) leucine rich repeat and Ig domain containing 4
Horse(100060105) leucine rich repeat and Ig domain containing 4
sheep(101118846) leucine rich repeat and Ig domain containing 4
domestic guinea pig(100726611) leucine rich repeat and Ig domain containing 4
naked mole-rat(101699842) leucine rich repeat and Ig domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024431 MISSION® esiRNA esiRNA targeting mouse Lingo4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004432 Rosetta Predictions human pricing
NM_001109189 Rosetta Predictions rat pricing
NM_177250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214558 predicted 1863
2 SASI_Hs01_00214559 predicted 2146
3 SASI_Hs01_00214560 predicted 2292
4 SASI_Hs01_00214561 predicted 2316
5 SASI_Hs01_00214562 predicted 608
6 SASI_Hs01_00214563 predicted 1224
7 SASI_Hs01_00214564 predicted 2382
8 SASI_Hs01_00214565 predicted 1562
9 SASI_Hs02_00304586 predicted 1876
10 SASI_Hs01_00214566 predicted 2025
11 SASI_Hs01_00214567 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246000 predicted 5024
2 SASI_Rn02_00246001 predicted 5497
3 SASI_Rn02_00246002 predicted 4221
4 SASI_Rn02_00246003 predicted 4333
5 SASI_Rn02_00246004 predicted 4838
6 SASI_Rn02_00246005 predicted 4277
7 SASI_Rn02_00246006 predicted 4262
8 SASI_Rn02_00246007 predicted 4349
9 SASI_Rn02_00246008 predicted 5595
10 SASI_Rn02_00246009 predicted 4378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178269 predicted 1107
2 SASI_Mm01_00178270 predicted 1921
3 SASI_Mm02_00347286 predicted 699
4 SASI_Mm01_00178272 predicted 1309
5 SASI_Mm01_00178274 predicted 1273
6 SASI_Mm01_00178275 predicted 758
7 SASI_Mm01_00178276 predicted 397
8 SASI_Mm01_00178277 predicted 1083
9 SASI_Mm01_00178278 predicted 2017
10 SASI_Mm02_00347287 predicted 2110
11 SASI_Mm01_00178271 predicted 892
12 SASI_Mm01_00178273 predicted 1267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004432
LINGO4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004432.1-2274s1c1
Sequence:CCGGGCTAGTCTAACCACTAGGCTTCTCGAGAAGCCTAGTGGTTAGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004432.2-1705s21c1
Sequence:CCGGACCACCAAACGGCACACTTTCCTCGAGGAAAGTGTGCCGTTTGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004432.2-819s21c1
Sequence:CCGGGGCTTAGAGAACTGGATATTGCTCGAGCAATATCCAGTTCTCTAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004432.1-2291s1c1
Sequence:CCGGGCTTTCTTCACACATGCTTATCTCGAGATAAGCATGTGTGAAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-620s1c1
Sequence:CCGGCAGATTGTTCTCTTCCTAGATCTCGAGATCTAGGAAGAGAACAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-1220s1c1
Sequence:CCGGGCTTTCCCTTCTCCAGACAAACTCGAGTTTGTCTGGAGAAGGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-1635s1c1
Sequence:CCGGCCTATGTCTGTGTGGTTAGCACTCGAGTGCTAACCACACAGACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004432
LINGO4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004432.1-2274s1c1
Sequence:CCGGGCTAGTCTAACCACTAGGCTTCTCGAGAAGCCTAGTGGTTAGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004432.2-1705s21c1
Sequence:CCGGACCACCAAACGGCACACTTTCCTCGAGGAAAGTGTGCCGTTTGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004432.2-819s21c1
Sequence:CCGGGGCTTAGAGAACTGGATATTGCTCGAGCAATATCCAGTTCTCTAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004432.1-2291s1c1
Sequence:CCGGGCTTTCTTCACACATGCTTATCTCGAGATAAGCATGTGTGAAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-620s1c1
Sequence:CCGGCAGATTGTTCTCTTCCTAGATCTCGAGATCTAGGAAGAGAACAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-1220s1c1
Sequence:CCGGGCTTTCCCTTCTCCAGACAAACTCGAGTTTGTCTGGAGAAGGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-1635s1c1
Sequence:CCGGCCTATGTCTGTGTGGTTAGCACTCGAGTGCTAACCACACAGACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004432
LINGO4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004432.1-2274s1c1
Sequence:CCGGGCTAGTCTAACCACTAGGCTTCTCGAGAAGCCTAGTGGTTAGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004432.2-1705s21c1
Sequence:CCGGACCACCAAACGGCACACTTTCCTCGAGGAAAGTGTGCCGTTTGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004432.2-819s21c1
Sequence:CCGGGGCTTAGAGAACTGGATATTGCTCGAGCAATATCCAGTTCTCTAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004432.1-2291s1c1
Sequence:CCGGGCTTTCTTCACACATGCTTATCTCGAGATAAGCATGTGTGAAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-620s1c1
Sequence:CCGGCAGATTGTTCTCTTCCTAGATCTCGAGATCTAGGAAGAGAACAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-1220s1c1
Sequence:CCGGGCTTTCCCTTCTCCAGACAAACTCGAGTTTGTCTGGAGAAGGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004432.1-1635s1c1
Sequence:CCGGCCTATGTCTGTGTGGTTAGCACTCGAGTGCTAACCACACAGACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177250
LINGO4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and Ig domain containing 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177250.2-2370s1c1
Sequence:CCGGGCCAAACACAACCACAAGATTCTCGAGAATCTTGTGGTTGTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-1729s1c1
Sequence:CCGGGTCAGTAATGTCGCTGGGAATCTCGAGATTCCCAGCGACATTACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-1922s1c1
Sequence:CCGGGCTTTGGTCTGATTGCTCTTTCTCGAGAAAGAGCAATCAGACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-693s1c1
Sequence:CCGGCCTCAATCAGATTGTCCTCTTCTCGAGAAGAGGACAATCTGATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-807s1c1
Sequence:CCGGGCTGGCCAAGTTAAGTACCATCTCGAGATGGTACTTAACTTGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177250.2-2031s21c1
Sequence:CCGGTCGGGTCACTGCCAAGTTATTCTCGAGAATAACTTGGCAGTGACCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177250
LINGO4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and Ig domain containing 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177250.2-2370s1c1
Sequence:CCGGGCCAAACACAACCACAAGATTCTCGAGAATCTTGTGGTTGTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-1729s1c1
Sequence:CCGGGTCAGTAATGTCGCTGGGAATCTCGAGATTCCCAGCGACATTACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-1922s1c1
Sequence:CCGGGCTTTGGTCTGATTGCTCTTTCTCGAGAAAGAGCAATCAGACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-693s1c1
Sequence:CCGGCCTCAATCAGATTGTCCTCTTCTCGAGAAGAGGACAATCTGATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-807s1c1
Sequence:CCGGGCTGGCCAAGTTAAGTACCATCTCGAGATGGTACTTAACTTGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177250.2-2031s21c1
Sequence:CCGGTCGGGTCACTGCCAAGTTATTCTCGAGAATAACTTGGCAGTGACCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177250
LINGO4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and Ig domain containing 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177250.2-2370s1c1
Sequence:CCGGGCCAAACACAACCACAAGATTCTCGAGAATCTTGTGGTTGTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-1729s1c1
Sequence:CCGGGTCAGTAATGTCGCTGGGAATCTCGAGATTCCCAGCGACATTACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-1922s1c1
Sequence:CCGGGCTTTGGTCTGATTGCTCTTTCTCGAGAAAGAGCAATCAGACCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-693s1c1
Sequence:CCGGCCTCAATCAGATTGTCCTCTTCTCGAGAAGAGGACAATCTGATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177250.2-807s1c1
Sequence:CCGGGCTGGCCAAGTTAAGTACCATCTCGAGATGGTACTTAACTTGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177250.2-2031s21c1
Sequence:CCGGTCGGGTCACTGCCAAGTTATTCTCGAGAATAACTTGGCAGTGACCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)