EMAIL THIS PAGE TO A FRIEND

LINS

lines homolog (Drosophila)

88 Gene Product Result for
Synonyms: LINS1 WINS1
UniProtKB ID: Q8NG48, Q96FW2, Q9NVQ3
Gene ID:
Human(55180) Summary: The Drosophila segment polarity gene lin encodes a protein, lines, which plays important roles in development of the epidermis and hindgut. This gene encodes a protein containing a lines-like domain. This gene is located on chromosome 15 and clustered with the gene encoding ankyrin repeat and SOCS box-containing protein 7. [provided by RefSeq, Sep 2010]
Mouse(72635) lines homolog (Drosophila)
Rat(308704) lines homolog (Drosophila)
chicken(430374) lines homolog (Drosophila)
dog(607902) lines homolog (Drosophila)
Horse(100056717) lines homolog (Drosophila)
cow(539267) lines homolog (Drosophila)
domestic cat(101080795) lines homolog (Drosophila)
domestic guinea pig(100715913) lines homolog (Drosophila)
naked mole-rat(101701983) lines homolog (Drosophila)
sheep(101116177) lines homolog (Drosophila)
Domestic Rabbit(100339028) lines homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018148 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040614 Rosetta Predictions human pricing
NM_001040615 Rosetta Predictions human pricing
NM_001040616 Rosetta Predictions human pricing
NM_018148 Rosetta Predictions human pricing
XM_001059713 Rosetta Predictions rat pricing
XM_218748 Rosetta Predictions rat pricing
NM_152815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071333 predicted 1749
2 SASI_Hs01_00071335 predicted 1531
3 SASI_Hs01_00071336 predicted 1463
4 SASI_Hs01_00071337 predicted 708
5 SASI_Hs01_00071338 predicted 1126
6 SASI_Hs01_00071339 predicted 1906
7 SASI_Hs01_00071340 predicted 2020
8 SASI_Hs02_00309010 predicted 568
9 SASI_Hs01_00071341 predicted 549
10 SASI_Hs01_00071342 predicted 824
11 SASI_Hs01_00071334 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038303 predicted 1639
2 SASI_Hs01_00038305 predicted 1427
3 SASI_Hs01_00038306 predicted 1356
4 SASI_Hs01_00038307 predicted 604
5 SASI_Hs01_00038308 predicted 1025
6 SASI_Hs01_00038309 predicted 1796
7 SASI_Hs01_00038310 predicted 1924
8 SASI_Hs02_00309011 predicted 462
9 SASI_Hs01_00038311 predicted 436
10 SASI_Hs01_00038312 predicted 719
11 SASI_Hs01_00038304 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237836 predicted 1643
2 SASI_Hs01_00237838 predicted 1419
3 SASI_Hs01_00237839 predicted 1354
4 SASI_Hs01_00237840 predicted 599
5 SASI_Hs01_00237841 predicted 1019
6 SASI_Hs01_00237842 predicted 1789
7 SASI_Hs01_00237843 predicted 1914
8 SASI_Hs02_00309012 predicted 456
9 SASI_Hs01_00237844 predicted 440
10 SASI_Hs01_00237845 predicted 709
11 SASI_Hs01_00237837 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042522 predicted 1750
2 SASI_Hs01_00042524 predicted 1534
3 SASI_Hs01_00042525 predicted 1470
4 SASI_Hs01_00042526 predicted 708
5 SASI_Hs01_00042527 predicted 1131
6 SASI_Hs01_00042528 predicted 1902
7 SASI_Hs01_00042529 predicted 2031
8 SASI_Hs02_00351380 predicted 572
9 SASI_Hs01_00042530 predicted 551
10 SASI_Hs01_00042531 predicted 828
11 SASI_Hs01_00042523 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294058 predicted 1457
2 SASI_Rn02_00294059 predicted 1159
3 SASI_Rn02_00294060 predicted 879
4 SASI_Rn02_00294061 predicted 372
5 SASI_Rn02_00294062 predicted 927
6 SASI_Rn02_00294063 predicted 1384
7 SASI_Rn02_00294064 predicted 1841
8 SASI_Rn02_00294065 predicted 1667
9 SASI_Rn02_00294066 predicted 1630
10 SASI_Rn02_00294067 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378032 predicted 496
2 SASI_Rn02_00378033 predicted 784
3 SASI_Rn02_00378034 predicted 876
4 SASI_Rn02_00378035 predicted 373
5 SASI_Rn02_00378036 predicted 415
6 SASI_Rn02_00378037 predicted 924
7 SASI_Rn02_00378038 predicted 597
8 SASI_Rn02_00378039 predicted 583
9 SASI_Rn02_00378040 predicted 664
10 SASI_Rn02_00378041 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030973 predicted 1423
2 SASI_Mm01_00030974 predicted 1147
3 SASI_Mm01_00030975 predicted 1563
4 SASI_Mm02_00342824 predicted 1135
5 SASI_Mm01_00030976 predicted 1886
6 SASI_Mm01_00030977 predicted 985
7 SASI_Mm01_00030980 predicted 1125
8 SASI_Mm01_00030981 predicted 867
9 SASI_Mm01_00030982 predicted 1565
10 SASI_Mm02_00342825 predicted 1878
11 SASI_Mm01_00030978 predicted 1910
12 SASI_Mm01_00030979 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018148
VALIDATED
LINS MISSION shRNA Bacterial Glycerol Stock
lines homolog (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-636s21c1
Sequence:CCGGAGCAGTACAGAGATGTAATTACTCGAGTAATTACATCTCTGTACTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1930s21c1
Sequence:CCGGTGATGCAACTGAATCTAAATACTCGAGTATTTAGATTCAGTTGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-2020s21c1
Sequence:CCGGTCGTTTGACTGCTCCTCATAGCTCGAGCTATGAGGAGCAGTCAAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018148.3-956s1c1
Sequence:CCGGGAAGTTATTACCTGGCCTATTCTCGAGAATAGGCCAGGTAATAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-1391s1c1
Sequence:CCGGCAATTACACAATCCGTGCAAACTCGAGTTTGCACGGATTGTGTAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-1194s1c1
Sequence:CCGGGTGATGAAGTTCAACCTGAATCTCGAGATTCAGGTTGAACTTCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1246s21c1
Sequence:CCGGTGGATCTGTGCCTGCCTTAATCTCGAGATTAAGGCAGGCACAGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1659s21c1
Sequence:CCGGCATCACTGGGCATCTACTTAACTCGAGTTAAGTAGATGCCCAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-2249s21c1
Sequence:CCGGTTACACCAGCAAGCAACTAAGCTCGAGCTTAGTTGCTTGCTGGTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1758s21c1
Sequence:CCGGGCTATAATCCTCACTGTATTTCTCGAGAAATACAGTGAGGATTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-751s1c1
Sequence:CCGGCCTGACTCATTTCGACACCATCTCGAGATGGTGTCGAAATGAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-2026s1c1
Sequence:CCGGGCAGTGTTTAGCTAACAGTAACTCGAGTTACTGTTAGCTAAACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018148
VALIDATED
LINS MISSION shRNA shRNA Plasmid DNA
lines homolog (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-636s21c1
Sequence:CCGGAGCAGTACAGAGATGTAATTACTCGAGTAATTACATCTCTGTACTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1930s21c1
Sequence:CCGGTGATGCAACTGAATCTAAATACTCGAGTATTTAGATTCAGTTGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-2020s21c1
Sequence:CCGGTCGTTTGACTGCTCCTCATAGCTCGAGCTATGAGGAGCAGTCAAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018148.3-956s1c1
Sequence:CCGGGAAGTTATTACCTGGCCTATTCTCGAGAATAGGCCAGGTAATAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-1391s1c1
Sequence:CCGGCAATTACACAATCCGTGCAAACTCGAGTTTGCACGGATTGTGTAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-1194s1c1
Sequence:CCGGGTGATGAAGTTCAACCTGAATCTCGAGATTCAGGTTGAACTTCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1246s21c1
Sequence:CCGGTGGATCTGTGCCTGCCTTAATCTCGAGATTAAGGCAGGCACAGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1659s21c1
Sequence:CCGGCATCACTGGGCATCTACTTAACTCGAGTTAAGTAGATGCCCAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-2249s21c1
Sequence:CCGGTTACACCAGCAAGCAACTAAGCTCGAGCTTAGTTGCTTGCTGGTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1758s21c1
Sequence:CCGGGCTATAATCCTCACTGTATTTCTCGAGAAATACAGTGAGGATTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-751s1c1
Sequence:CCGGCCTGACTCATTTCGACACCATCTCGAGATGGTGTCGAAATGAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-2026s1c1
Sequence:CCGGGCAGTGTTTAGCTAACAGTAACTCGAGTTACTGTTAGCTAAACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018148
VALIDATED
LINS MISSION shRNA Lentiviral Transduction Particles
lines homolog (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-636s21c1
Sequence:CCGGAGCAGTACAGAGATGTAATTACTCGAGTAATTACATCTCTGTACTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1930s21c1
Sequence:CCGGTGATGCAACTGAATCTAAATACTCGAGTATTTAGATTCAGTTGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-2020s21c1
Sequence:CCGGTCGTTTGACTGCTCCTCATAGCTCGAGCTATGAGGAGCAGTCAAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018148.3-956s1c1
Sequence:CCGGGAAGTTATTACCTGGCCTATTCTCGAGAATAGGCCAGGTAATAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-1391s1c1
Sequence:CCGGCAATTACACAATCCGTGCAAACTCGAGTTTGCACGGATTGTGTAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-1194s1c1
Sequence:CCGGGTGATGAAGTTCAACCTGAATCTCGAGATTCAGGTTGAACTTCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1246s21c1
Sequence:CCGGTGGATCTGTGCCTGCCTTAATCTCGAGATTAAGGCAGGCACAGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1659s21c1
Sequence:CCGGCATCACTGGGCATCTACTTAACTCGAGTTAAGTAGATGCCCAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-2249s21c1
Sequence:CCGGTTACACCAGCAAGCAACTAAGCTCGAGCTTAGTTGCTTGCTGGTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018148.4-1758s21c1
Sequence:CCGGGCTATAATCCTCACTGTATTTCTCGAGAAATACAGTGAGGATTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-751s1c1
Sequence:CCGGCCTGACTCATTTCGACACCATCTCGAGATGGTGTCGAAATGAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018148.3-2026s1c1
Sequence:CCGGGCAGTGTTTAGCTAACAGTAACTCGAGTTACTGTTAGCTAAACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152815
LINS MISSION shRNA Bacterial Glycerol Stock
lines homolog (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1886s21c1
Sequence:CCGGGAAACCACAAGTGAGCATTTACTCGAGTAAATGCTCACTTGTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1840s21c1
Sequence:CCGGACCGCAGAGTCTGGTAGATTACTCGAGTAATCTACCAGACTCTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1120s21c1
Sequence:CCGGCCTGAGAGCAGCAAGCTTAATCTCGAGATTAAGCTTGCTGCTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-1890s1c1
Sequence:CCGGCCACAAGTGAGCATTTAGCAACTCGAGTTGCTAAATGCTCACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-830s1c1
Sequence:CCGGGATATTCTTGCCTGGCCTATTCTCGAGAATAGGCCAGGCAAGAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-968s1c1
Sequence:CCGGGACAGTGACATGCTCACTTTACTCGAGTAAAGTGAGCATGTCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1526s21c1
Sequence:CCGGGAGACCTGTTTCCTTGAATATCTCGAGATATTCAAGGAAACAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1221s21c1
Sequence:CCGGCCGAGCTACTGGCCTTCTTAACTCGAGTTAAGAAGGCCAGTAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152815
LINS MISSION shRNA shRNA Plasmid DNA
lines homolog (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1886s21c1
Sequence:CCGGGAAACCACAAGTGAGCATTTACTCGAGTAAATGCTCACTTGTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1840s21c1
Sequence:CCGGACCGCAGAGTCTGGTAGATTACTCGAGTAATCTACCAGACTCTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1120s21c1
Sequence:CCGGCCTGAGAGCAGCAAGCTTAATCTCGAGATTAAGCTTGCTGCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-1890s1c1
Sequence:CCGGCCACAAGTGAGCATTTAGCAACTCGAGTTGCTAAATGCTCACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-830s1c1
Sequence:CCGGGATATTCTTGCCTGGCCTATTCTCGAGAATAGGCCAGGCAAGAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-968s1c1
Sequence:CCGGGACAGTGACATGCTCACTTTACTCGAGTAAAGTGAGCATGTCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1526s21c1
Sequence:CCGGGAGACCTGTTTCCTTGAATATCTCGAGATATTCAAGGAAACAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1221s21c1
Sequence:CCGGCCGAGCTACTGGCCTTCTTAACTCGAGTTAAGAAGGCCAGTAGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152815
LINS MISSION shRNA Lentiviral Transduction Particles
lines homolog (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1886s21c1
Sequence:CCGGGAAACCACAAGTGAGCATTTACTCGAGTAAATGCTCACTTGTGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1840s21c1
Sequence:CCGGACCGCAGAGTCTGGTAGATTACTCGAGTAATCTACCAGACTCTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1120s21c1
Sequence:CCGGCCTGAGAGCAGCAAGCTTAATCTCGAGATTAAGCTTGCTGCTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-1890s1c1
Sequence:CCGGCCACAAGTGAGCATTTAGCAACTCGAGTTGCTAAATGCTCACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-830s1c1
Sequence:CCGGGATATTCTTGCCTGGCCTATTCTCGAGAATAGGCCAGGCAAGAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152815.1-968s1c1
Sequence:CCGGGACAGTGACATGCTCACTTTACTCGAGTAAAGTGAGCATGTCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1526s21c1
Sequence:CCGGGAGACCTGTTTCCTTGAATATCTCGAGATATTCAAGGAAACAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152815.1-1221s21c1
Sequence:CCGGCCGAGCTACTGGCCTTCTTAACTCGAGTTAAGAAGGCCAGTAGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)