EMAIL THIS PAGE TO A FRIEND

LIPA

lipase A, lysosomal acid, cholesterol esterase

73 Gene Product Result for
Synonyms: CESD LAL
Gene ID:
Human(3988) Summary: This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16889) lysosomal acid lipase A
Rat(25055) lipase A, lysosomal acid, cholesterol esterase
chicken(423789) lipase A, lysosomal acid, cholesterol esterase (Wolman disease)
cow(100125267) lipase A, lysosomal acid, cholesterol esterase
Horse(100071626) lipase A, lysosomal acid, cholesterol esterase
domestic cat(101094134) lipase A, lysosomal acid, cholesterol esterase
dog(610650) lipase A, lysosomal acid, cholesterol esterase
sheep(100145859) lipase A, lysosomal acid, cholesterol esterase
domestic guinea pig(100727234) lipase A, lysosomal acid, cholesterol esterase
naked mole-rat(101713991) lipase A, lysosomal acid, cholesterol esterase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000235 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000235 Rosetta Predictions human pricing
NM_001127605 Rosetta Predictions human pricing
NM_012732 Rosetta Predictions rat pricing
NM_001111100 Rosetta Predictions mouse pricing
NM_021460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141713 predicted 1244
2 SASI_Hs02_00302146 predicted 1139
3 SASI_Hs01_00141714 predicted 1398
4 SASI_Hs01_00141716 predicted 789
5 SASI_Hs02_00302147 predicted 564
6 SASI_Hs01_00141717 predicted 816
7 SASI_Hs01_00141718 predicted 1133
8 SASI_Hs01_00141719 predicted 683
9 SASI_Hs01_00141720 predicted 894
10 SASI_Hs02_00302148 predicted 445
11 SASI_Hs01_00141712 predicted 329
12 SASI_Hs01_00141715 predicted 316
13 SASI_Hs01_00141721 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329844 predicted 1273
2 SASI_Hs02_00329845 predicted 1173
3 SASI_Hs02_00329846 predicted 1421
4 SASI_Hs02_00329847 predicted 817
5 SASI_Hs02_00329848 predicted 589
6 SASI_Hs02_00329849 predicted 844
7 SASI_Hs02_00329850 predicted 1158
8 SASI_Hs02_00329851 predicted 705
9 SASI_Hs02_00329852 predicted 930
10 SASI_Hs02_00329853 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062070 predicted 1521
2 SASI_Rn01_00062071 predicted 545
3 SASI_Rn02_00260076 predicted 1325
4 SASI_Rn01_00062072 predicted 487
5 SASI_Rn02_00260077 predicted 490
6 SASI_Rn01_00062073 predicted 346
7 SASI_Rn01_00062075 predicted 636
8 SASI_Rn01_00062076 predicted 1275
9 SASI_Rn01_00062077 predicted 798
10 SASI_Rn01_00062078 predicted 1095
11 SASI_Rn01_00062069 predicted 458
12 SASI_Rn01_00062074 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306402 predicted 377
2 SASI_Mm02_00306403 predicted 371
3 SASI_Mm02_00306404 predicted 588
4 SASI_Mm02_00306405 predicted 911
5 SASI_Mm02_00306406 predicted 864
6 SASI_Mm02_00306407 predicted 472
7 SASI_Mm02_00306408 predicted 849
8 SASI_Mm02_00306409 predicted 922
9 SASI_Mm02_00306410 predicted 485
10 SASI_Mm02_00306411 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114832 predicted 373
2 SASI_Mm01_00114833 predicted 379
3 SASI_Mm01_00114834 predicted 595
4 SASI_Mm01_00114835 predicted 907
5 SASI_Mm01_00114836 predicted 860
6 SASI_Mm02_00326111 predicted 481
7 SASI_Mm01_00114837 predicted 855
8 SASI_Mm01_00114840 predicted 923
9 SASI_Mm01_00114841 predicted 491
10 SASI_Mm02_00326112 predicted 910
11 SASI_Mm01_00114838 predicted 570
12 SASI_Mm01_00114839 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021460
VALIDATED
LIPA MISSION shRNA Bacterial Glycerol Stock
lipase A, lysosomal acid, cholesterol esterase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-1156s21c1
Sequence:CCGGTCAATGACATCACTATCTTACCTCGAGGTAAGATAGTGATGTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-100s1c1
Sequence:CCGGGATCCTGAAGTCAACATGAATCTCGAGATTCATGTTGACTTCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021460.1-806s1c1
Sequence:CCGGGTGGCTTCAATGAGAAGAATTCTCGAGAATTCTTCTCATTGAAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-676s1c1
Sequence:CCGGCCTCTTCTCAAGGACATGTTTCTCGAGAAACATGTCCTTGAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-1580s1c1
Sequence:CCGGCCTCAGTTACTTCCCATCTTACTCGAGTAAGATGGGAAGTAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-181s1c1
Sequence:CCGGGATGGCTATATTCTGAGTATTCTCGAGAATACTCAGAATATAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021460.3-672s21c1
Sequence:CCGGGAGTTGGCAAAGAAGATTAAACTCGAGTTTAATCTTCTTTGCCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-195s21c1
Sequence:CCGGGATCCTGAAGTCAACATGAATCTCGAGATTCATGTTGACTTCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-1678s21c1
Sequence:CCGGCCTCAGTTACTTCCCATCTTACTCGAGTAAGATGGGAAGTAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021460.3-1078s21c1
Sequence:CCGGTTCCTCCCTCGTACAACATAACTCGAGTTATGTTGTACGAGGGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021460
VALIDATED
LIPA MISSION shRNA shRNA Plasmid DNA
lipase A, lysosomal acid, cholesterol esterase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-1156s21c1
Sequence:CCGGTCAATGACATCACTATCTTACCTCGAGGTAAGATAGTGATGTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-100s1c1
Sequence:CCGGGATCCTGAAGTCAACATGAATCTCGAGATTCATGTTGACTTCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021460.1-806s1c1
Sequence:CCGGGTGGCTTCAATGAGAAGAATTCTCGAGAATTCTTCTCATTGAAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-676s1c1
Sequence:CCGGCCTCTTCTCAAGGACATGTTTCTCGAGAAACATGTCCTTGAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-1580s1c1
Sequence:CCGGCCTCAGTTACTTCCCATCTTACTCGAGTAAGATGGGAAGTAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-181s1c1
Sequence:CCGGGATGGCTATATTCTGAGTATTCTCGAGAATACTCAGAATATAGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021460.3-672s21c1
Sequence:CCGGGAGTTGGCAAAGAAGATTAAACTCGAGTTTAATCTTCTTTGCCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-195s21c1
Sequence:CCGGGATCCTGAAGTCAACATGAATCTCGAGATTCATGTTGACTTCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-1678s21c1
Sequence:CCGGCCTCAGTTACTTCCCATCTTACTCGAGTAAGATGGGAAGTAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021460.3-1078s21c1
Sequence:CCGGTTCCTCCCTCGTACAACATAACTCGAGTTATGTTGTACGAGGGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021460
VALIDATED
LIPA MISSION shRNA Lentiviral Transduction Particles
lipase A, lysosomal acid, cholesterol esterase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-1156s21c1
Sequence:CCGGTCAATGACATCACTATCTTACCTCGAGGTAAGATAGTGATGTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-100s1c1
Sequence:CCGGGATCCTGAAGTCAACATGAATCTCGAGATTCATGTTGACTTCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021460.1-806s1c1
Sequence:CCGGGTGGCTTCAATGAGAAGAATTCTCGAGAATTCTTCTCATTGAAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-676s1c1
Sequence:CCGGCCTCTTCTCAAGGACATGTTTCTCGAGAAACATGTCCTTGAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-1580s1c1
Sequence:CCGGCCTCAGTTACTTCCCATCTTACTCGAGTAAGATGGGAAGTAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021460.1-181s1c1
Sequence:CCGGGATGGCTATATTCTGAGTATTCTCGAGAATACTCAGAATATAGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021460.3-672s21c1
Sequence:CCGGGAGTTGGCAAAGAAGATTAAACTCGAGTTTAATCTTCTTTGCCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-195s21c1
Sequence:CCGGGATCCTGAAGTCAACATGAATCTCGAGATTCATGTTGACTTCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021460.3-1678s21c1
Sequence:CCGGCCTCAGTTACTTCCCATCTTACTCGAGTAAGATGGGAAGTAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021460.3-1078s21c1
Sequence:CCGGTTCCTCCCTCGTACAACATAACTCGAGTTATGTTGTACGAGGGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000235
VALIDATED
LIPA MISSION shRNA Bacterial Glycerol Stock
lipase A, lysosomal acid, cholesterol esterase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-930s1c1
Sequence:CCGGGCCAGGCTGTTAAATTCCAAACTCGAGTTTGGAATTTAACAGCCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000235.1-775s1c1
Sequence:CCGGCCACGTTTGCACTCATGTCATCTCGAGATGACATGAGTGCAAACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_000235.1-278s1c1
Sequence:CCGGCCAGTTGTCTTCCTGCAACATCTCGAGATGTTGCAGGAAGACAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-1082s1c1
Sequence:CCGGGCAGATGTCTACGACGTCAATCTCGAGATTGACGTCGTAGACATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-539s1c1
Sequence:CCGGCAAGTGTATTATGTGGGTCATCTCGAGATGACCCACATAATACACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-1058s21c1
Sequence:CCGGGCCAGGCTGTTAAATTCCAAACTCGAGTTTGGAATTTAACAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000235.2-1581s21c1
Sequence:CCGGCAGTGTCTCAACCATAGTATTCTCGAGAATACTATGGTTGAGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-667s21c1
Sequence:CCGGCAAGTGTATTATGTGGGTCATCTCGAGATGACCCACATAATACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-1210s21c1
Sequence:CCGGGCAGATGTCTACGACGTCAATCTCGAGATTGACGTCGTAGACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000235
VALIDATED
LIPA MISSION shRNA shRNA Plasmid DNA
lipase A, lysosomal acid, cholesterol esterase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-930s1c1
Sequence:CCGGGCCAGGCTGTTAAATTCCAAACTCGAGTTTGGAATTTAACAGCCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000235.1-775s1c1
Sequence:CCGGCCACGTTTGCACTCATGTCATCTCGAGATGACATGAGTGCAAACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_000235.1-278s1c1
Sequence:CCGGCCAGTTGTCTTCCTGCAACATCTCGAGATGTTGCAGGAAGACAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-1082s1c1
Sequence:CCGGGCAGATGTCTACGACGTCAATCTCGAGATTGACGTCGTAGACATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-539s1c1
Sequence:CCGGCAAGTGTATTATGTGGGTCATCTCGAGATGACCCACATAATACACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-1058s21c1
Sequence:CCGGGCCAGGCTGTTAAATTCCAAACTCGAGTTTGGAATTTAACAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000235.2-1581s21c1
Sequence:CCGGCAGTGTCTCAACCATAGTATTCTCGAGAATACTATGGTTGAGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-667s21c1
Sequence:CCGGCAAGTGTATTATGTGGGTCATCTCGAGATGACCCACATAATACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-1210s21c1
Sequence:CCGGGCAGATGTCTACGACGTCAATCTCGAGATTGACGTCGTAGACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000235
VALIDATED
LIPA MISSION shRNA Lentiviral Transduction Particles
lipase A, lysosomal acid, cholesterol esterase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-930s1c1
Sequence:CCGGGCCAGGCTGTTAAATTCCAAACTCGAGTTTGGAATTTAACAGCCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000235.1-775s1c1
Sequence:CCGGCCACGTTTGCACTCATGTCATCTCGAGATGACATGAGTGCAAACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_000235.1-278s1c1
Sequence:CCGGCCAGTTGTCTTCCTGCAACATCTCGAGATGTTGCAGGAAGACAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-1082s1c1
Sequence:CCGGGCAGATGTCTACGACGTCAATCTCGAGATTGACGTCGTAGACATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000235.1-539s1c1
Sequence:CCGGCAAGTGTATTATGTGGGTCATCTCGAGATGACCCACATAATACACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-1058s21c1
Sequence:CCGGGCCAGGCTGTTAAATTCCAAACTCGAGTTTGGAATTTAACAGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000235.2-1581s21c1
Sequence:CCGGCAGTGTCTCAACCATAGTATTCTCGAGAATACTATGGTTGAGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-667s21c1
Sequence:CCGGCAAGTGTATTATGTGGGTCATCTCGAGATGACCCACATAATACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000235.2-1210s21c1
Sequence:CCGGGCAGATGTCTACGACGTCAATCTCGAGATTGACGTCGTAGACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)