EMAIL THIS PAGE TO A FRIEND

LIPC

lipase, hepatic

51 Gene Product Result for
Synonyms: HDLCQ12 HL HTGL LIPH
UniProtKB ID: P11150, A2RUB4, A8K9B6, O43571, P78529, Q99465
Gene ID:
Human(3990) Summary: LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
Mouse(15450) lipase, hepatic
Rat(24538) lipase, hepatic
chicken(427495) lipase, hepatic
domestic cat(101082239) lipase, hepatic
dog(478320) lipase, hepatic
cow(535192) lipase, hepatic
naked mole-rat(101698662) lipase, hepatic
sheep(101116992) lipase, hepatic
Domestic Rabbit(100008678) lipase, hepatic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000236 Rosetta Predictions human pricing
NM_012597 Rosetta Predictions rat pricing
NM_008280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052238 predicted 252
2 SASI_Hs01_00052240 predicted 532
3 SASI_Hs01_00052241 predicted 354
4 SASI_Hs01_00052242 predicted 235
5 SASI_Hs01_00052243 predicted 601
6 SASI_Hs02_00302149 predicted 1007
7 SASI_Hs01_00052244 predicted 1139
8 SASI_Hs02_00302150 predicted 667
9 SASI_Hs01_00052245 predicted 222
10 SASI_Hs01_00052246 predicted 1226
11 SASI_Hs01_00052239 predicted 673
12 SASI_Hs01_00052247 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100481 predicted 1152
2 SASI_Rn01_00100482 predicted 890
3 SASI_Rn01_00100483 predicted 878
4 SASI_Rn01_00100485 predicted 1421
5 SASI_Rn01_00100486 predicted 1052
6 SASI_Rn02_00259747 predicted 225
7 SASI_Rn01_00100487 predicted 902
8 SASI_Rn01_00100488 predicted 381
9 SASI_Rn01_00100490 predicted 567
10 SASI_Rn02_00259748 predicted 1037
11 SASI_Rn01_00100484 predicted 235
12 SASI_Rn01_00100489 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053450 predicted 486
2 SASI_Mm01_00053451 predicted 1203
3 SASI_Mm01_00053452 predicted 1035
4 SASI_Mm01_00053453 predicted 1050
5 SASI_Mm01_00053454 predicted 293
6 SASI_Mm01_00053455 predicted 1042
7 SASI_Mm01_00053456 predicted 1182
8 SASI_Mm01_00053457 predicted 1192
9 SASI_Mm02_00313541 predicted 1441
10 SASI_Mm01_00053458 predicted 1483
11 SASI_Mm01_00053459 predicted 1390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000236
LIPC MISSION shRNA Bacterial Glycerol Stock
lipase, hepatic
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000050708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-532s1c1
Sequence:CCGGCGAAGCCATGTTCACCTAATTCTCGAGAATTAGGTGAACATGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-192s1c1
Sequence:CCGGGCATGAGATGAAGACCAGATTCTCGAGAATCTGGTCTTCATCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-121s1c1
Sequence:CCGGGCCCTTGGACAAAGCCTGAAACTCGAGTTTCAGGCTTTGTCCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-1175s1c1
Sequence:CCGGCCATGTCACTACTCGGAACAACTCGAGTTGTTCCGAGTAGTGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000236
LIPC MISSION shRNA shRNA Plasmid DNA
lipase, hepatic
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000050708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-532s1c1
Sequence:CCGGCGAAGCCATGTTCACCTAATTCTCGAGAATTAGGTGAACATGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-192s1c1
Sequence:CCGGGCATGAGATGAAGACCAGATTCTCGAGAATCTGGTCTTCATCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-121s1c1
Sequence:CCGGGCCCTTGGACAAAGCCTGAAACTCGAGTTTCAGGCTTTGTCCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-1175s1c1
Sequence:CCGGCCATGTCACTACTCGGAACAACTCGAGTTGTTCCGAGTAGTGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000236
LIPC MISSION shRNA Lentiviral Transduction Particles
lipase, hepatic
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000050708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-532s1c1
Sequence:CCGGCGAAGCCATGTTCACCTAATTCTCGAGAATTAGGTGAACATGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-192s1c1
Sequence:CCGGGCATGAGATGAAGACCAGATTCTCGAGAATCTGGTCTTCATCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-121s1c1
Sequence:CCGGGCCCTTGGACAAAGCCTGAAACTCGAGTTTCAGGCTTTGTCCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000236.1-1175s1c1
Sequence:CCGGCCATGTCACTACTCGGAACAACTCGAGTTGTTCCGAGTAGTGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008280
LIPC MISSION shRNA Bacterial Glycerol Stock
lipase, hepatic
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-554s1c1
Sequence:CCGGGAAGATAGTGAGTGCGCTGAACTCGAGTTCAGCGCACTCACTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1484s1c1
Sequence:CCGGCGAGTTGATCCTGCTCAAGTTCTCGAGAACTTGAGCAGGATCAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-627s1c1
Sequence:CCGGGCATACCAGCACTACACCATTCTCGAGAATGGTGTAGTGCTGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1754s1c1
Sequence:CCGGGAGTCAAGAGACCCATGCAAACTCGAGTTTGCATGGGTCTCTTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1424s1c1
Sequence:CCGGCGAAGGAATTACCAGCAATAACTCGAGTTATTGCTGGTAATTCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008280.2-1210s21c1
Sequence:CCGGGTTGCAACACTCTGGGTTATGCTCGAGCATAACCCAGAGTGTTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008280.2-1037s21c1
Sequence:CCGGCATTGCAGAGCATGGCTTAAACTCGAGTTTAAGCCATGCTCTGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008280
LIPC MISSION shRNA shRNA Plasmid DNA
lipase, hepatic
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-554s1c1
Sequence:CCGGGAAGATAGTGAGTGCGCTGAACTCGAGTTCAGCGCACTCACTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1484s1c1
Sequence:CCGGCGAGTTGATCCTGCTCAAGTTCTCGAGAACTTGAGCAGGATCAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-627s1c1
Sequence:CCGGGCATACCAGCACTACACCATTCTCGAGAATGGTGTAGTGCTGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1754s1c1
Sequence:CCGGGAGTCAAGAGACCCATGCAAACTCGAGTTTGCATGGGTCTCTTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1424s1c1
Sequence:CCGGCGAAGGAATTACCAGCAATAACTCGAGTTATTGCTGGTAATTCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008280.2-1210s21c1
Sequence:CCGGGTTGCAACACTCTGGGTTATGCTCGAGCATAACCCAGAGTGTTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008280.2-1037s21c1
Sequence:CCGGCATTGCAGAGCATGGCTTAAACTCGAGTTTAAGCCATGCTCTGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008280
LIPC MISSION shRNA Lentiviral Transduction Particles
lipase, hepatic
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-554s1c1
Sequence:CCGGGAAGATAGTGAGTGCGCTGAACTCGAGTTCAGCGCACTCACTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1484s1c1
Sequence:CCGGCGAGTTGATCCTGCTCAAGTTCTCGAGAACTTGAGCAGGATCAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-627s1c1
Sequence:CCGGGCATACCAGCACTACACCATTCTCGAGAATGGTGTAGTGCTGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1754s1c1
Sequence:CCGGGAGTCAAGAGACCCATGCAAACTCGAGTTTGCATGGGTCTCTTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008280.2-1424s1c1
Sequence:CCGGCGAAGGAATTACCAGCAATAACTCGAGTTATTGCTGGTAATTCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008280.2-1210s21c1
Sequence:CCGGGTTGCAACACTCTGGGTTATGCTCGAGCATAACCCAGAGTGTTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008280.2-1037s21c1
Sequence:CCGGCATTGCAGAGCATGGCTTAAACTCGAGTTTAAGCCATGCTCTGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)